v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-199a-5p URS0000554A4F_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCAGUGUUCAGACUACCUGUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 36 other species

  1. Capra hircus chi-miR-199a-5p
  2. Cavia porcellus cpo-miR-199-5p
  3. Columba livia (rock pigeon) cli-miR-199-5p
  4. Cricetulus griseus cgr-miR-199a
  5. Cyprinus carpio ccr-miR-199-5p
  6. Danio rerio dre-miR-199-5p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-199-5p
  8. Eptatretus burgeri Ebu-Mir-199-P6_5p (mature (guide))
  9. Equus caballus eca-miR-199a-5p
  10. Gallus gallus (chicken) gga-miR-199-5p
  11. Gorilla gorilla gorilla ggo-miR-199a (MIR199A)
  12. Gorilla gorilla (western gorilla) ggo-miR-199a
  13. Hippoglossus hippoglossus hhi-miR-199a
  14. Homo sapiens hsa-miR-199a-5p
  15. Ictalurus punctatus ipu-miR-199a-5p
  16. Lagothrix lagotricha lla-miR-199a
  17. Lepisosteus oculatus Loc-Mir-199-P2-v1_5p (mature (co-guide))
  18. Macaca mulatta (Rhesus monkey) mml-miR-199a
  19. Macaca nemestrina mne-miR-199a
  20. Mus musculus mmu-miR-199a-5p
  21. Ophiophagus hannah oha-miR-199c-5p
  22. Oryctolagus cuniculus (rabbit) ocu-miR-199a-5p
  23. Ovis aries (sheep) miscellaneous RNA
  24. Pan paniscus ppa-miR-199a
  25. Pan troglodytes (chimpanzee) ptr-miR-199a-5p
  26. Petromyzon marinus (sea lamprey) pma-miR-199a-5p
  27. Pongo pygmaeus ppy-miR-199a
  28. Rattus norvegicus rno-miR-199a-5p
  29. Saguinus labiatus (red-chested mustached tamarin) sla-miR-199a
  30. Salmo salar ssa-miR-199a-5p
  31. Sus scrofa (pig) ssc-miR-199a-5p
  32. Takifugu rubripes (torafugu) fru-miR-199
  33. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-199
  34. Tor tambroides (Thai mahseer) miR-199-5p
  35. Tursiops truncatus miR-199a
  36. Xenopus tropicalis (tropical clawed frog) xtr-miR-199a-5p