Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-199a-5p URS0000554A4F_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 10 databases (MirGeneDB, IntAct, GeneCards, PSICQUIC, TarBase, miRBase, MalaCards, ENA, RefSeq, LncBase). Described in 98 papers. Homo sapiens (human) hsa-miR-199a-5p sequence is a product of miR-199a, miR-199, hsa-miR-199a-5p, MIR199A1, miR-199a-5p, MIR199A2, MIR199A2/214, hsa-miR-199a genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16.3A5, 4.1N, 5'OY11.1, 8B, AAAT, ABCC1, ABL2, ABLL, AC092835.1, ACAD7.

Interactions 37

According to PSICQUIC and IntAct, Homo sapiens (human) hsa-miR-199a-5p interacts with:

Interaction id Participant Synonyms
EBI-25469983 intact:EBI-25469542 EBI-25469542 ENST00000414822 mrna_cdkn1c
URS0000554A4F_9606-0 P01130 P01130
URS0000554A4F_9606-19 P01130 P01130
URS0000554A4F_9606-20 P02649 P02649
URS0000554A4F_9606-1 P02649 P02649
URS0000554A4F_9606-21 P09544 P09544
URS0000554A4F_9606-2 P09544 P09544
URS0000554A4F_9606-3 P18850 P18850
URS0000554A4F_9606-22 P18850 P18850
URS0000554A4F_9606-23 P19838 P19838
URS0000554A4F_9606-4 P19838 P19838
URS0000554A4F_9606-5 P20339 P20339
URS0000554A4F_9606-24 P49841 P49841
URS0000554A4F_9606-25 P49841 P49841
URS0000554A4F_9606-6 P49841 P49841
URS0000554A4F_9606-7 P49841 P49841
URS0000554A4F_9606-8 P78504 P78504
URS0000554A4F_9606-26 P78504 P78504
URS0000554A4F_9606-9 P84022 P84022
URS0000554A4F_9606-10 Q00610 Q00610
URS0000554A4F_9606-27 Q00610 Q00610
URS0000554A4F_9606-28 Q03135 Q03135
URS0000554A4F_9606-11 Q03135 Q03135
URS0000554A4F_9606-29 Q03135 Q03135
URS0000554A4F_9606-12 Q03135 Q03135
URS0000554A4F_9606-13 Q03181 Q03181
URS0000554A4F_9606-30 Q03181 Q03181
URS0000554A4F_9606-14 Q04206 Q04206
URS0000554A4F_9606-31 Q04206 Q04206
URS0000554A4F_9606-15 Q13451 Q13451
URS0000554A4F_9606-32 Q13451 Q13451
URS0000554A4F_9606-33 Q8WW22 Q8WW22
URS0000554A4F_9606-16 Q8WW22 Q8WW22
URS0000554A4F_9606-34 Q9UL25 Q9UL25
URS0000554A4F_9606-17 Q9UL25 Q9UL25
URS0000554A4F_9606-35 Q9ULV1 Q9ULV1
URS0000554A4F_9606-18 Q9ULV1 Q9ULV1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCCAGUGUUCAGACUACCUGUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 105 other species

    1. Alligator mississippiensis Ami-Mir-199-P2-v1_5p* (star (passenger))
    2. Anolis carolinensis Aca-Mir-199-P2-v1_5p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-199-P2-v1_5p* (star (passenger))
    4. Canis lupus familiaris (dog) Cfa-Mir-199-P2-v1_5p* (star (passenger))
    5. Capra hircus chi-miR-199a-5p
    6. Cavia porcellus cpo-miR-199-5p
    7. Cervus elaphus (red deer) cel-miR-199a-5p
    8. Chrysemys picta bellii Cpi-Mir-199-P2-v1_5p* (star (passenger))
    9. Columba livia cli-miR-199-5p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-199a
    11. Cyprinus carpio (common carp) ccr-miR-199-5p
    12. Danio rerio dre-miR-199-5p
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-199-5p
    14. Echinops telfairi Ete-Mir-199-P2-v1_5p* (star (passenger))
    15. Equus caballus eca-miR-199a-5p
    16. Gallus gallus (chicken) gga-miR-199-5p
    17. Gorilla gorilla (western gorilla) ggo-miR-199a
    18. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-199a
    19. Ictalurus punctatus ipu-miR-199a-5p
    20. Lagothrix lagotricha (brown woolly monkey) lla-miR-199a
    21. Macaca mulatta mml-miR-199a-5p
    22. Macaca nemestrina mne-miR-199a
    23. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-199-P3-v1_5p* (star (passenger))
    24. Mus musculus mmu-miR-199a-5p
    25. Ophiophagus hannah oha-miR-199c-5p
    26. Ornithorhynchus anatinus Oan-Mir-199-P3-v1_5p* (star (passenger))
    27. Oryctolagus cuniculus ocu-miR-199a-5p
    28. Ovis aries (sheep) miscellaneous RNA
    29. Pan paniscus ppa-miR-199a
    30. Pan troglodytes (chimpanzee) ptr-miR-199a-5p
    31. Petromyzon marinus (sea lamprey) pma-miR-199a-5p
    32. Pongo pygmaeus ppy-miR-199a
    33. Rattus norvegicus rno-miR-199a-5p
    34. Saguinus labiatus sla-miR-199a
    35. Salmo salar ssa-miR-199a-5p
    36. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-199-P3-v1_5p* (star (passenger))
    37. Scyliorhinus torazame (cloudy catshark) Sto-Mir-199-P3-v1_5p* (star (passenger))
    38. Sus scrofa ssc-miR-199a-5p
    39. Taeniopygia guttata (zebra finch) Tgu-Mir-199-P3-v1_5p* (star (passenger))
    40. Takifugu rubripes fru-miR-199
    41. Tetraodon nigroviridis tni-miR-199
    42. Tor tambroides miR-199-5p
    43. Tursiops truncatus miR-199a
    44. Xenopus tropicalis xtr-miR-199a-5p