Automated summary: This piRNA sequence is 23 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (PirBase, miRBase, ENA, RefSeq). Gallus gallus (chicken) gga-miR-199-5p sequence is a product of miR-199, gga-miR-199-5p, gga-miR-199, MIR199B1, MIR199A2, miR-199-5p genes. Found in the Gallus gallus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CCCAGUGUUCAGACUACCUGUUC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.