Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-199-5p URS0000554A4F_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 3 databases (miRBase, ENA, RefSeq). Danio rerio (zebrafish) dre-miR-199-5p sequence is a product of dre-miR-199, miR-199, dre-miR-199-5p, miR-199-5p, mir199-1a, mir199-2a, mir199-3a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCCAGUGUUCAGACUACCUGUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 35 other species

    1. Alligator mississippiensis Ami-Mir-199-P2-v1_5p* (star (passenger))
    2. Anolis carolinensis Aca-Mir-199-P2-v1_5p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-199-P2-v1_5p* (star (passenger))
    4. Canis lupus familiaris (dog) Cfa-Mir-199-P2-v1_5p* (star (passenger))
    5. Capra hircus chi-miR-199a-5p
    6. Cavia porcellus cpo-miR-199-5p
    7. Cervus elaphus (red deer) cel-miR-199a-5p
    8. Chrysemys picta bellii Cpi-Mir-199-P2-v1_5p* (star (passenger))
    9. Columba livia (rock pigeon) cli-miR-199-5p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-199a
    11. Cyprinus carpio ccr-miR-199-5p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-199-5p
    13. Echinops telfairi Ete-Mir-199-P2-v1_5p* (star (passenger))
    14. Eptatretus burgeri (inshore hagfish) Ebu-Mir-199-P6_5p (mature (guide))
    15. Equus caballus eca-miR-199a-5p
    16. Gallus gallus gga-miR-199-5p
    17. Gorilla gorilla ggo-miR-199a
    18. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-199a
    19. Homo sapiens hsa-miR-199a-5p
    20. Ictalurus punctatus (channel catfish) ipu-miR-199a-5p
    21. Lagothrix lagotricha (brown woolly monkey) lla-miR-199a
    22. Lepisosteus oculatus (spotted gar) Loc-Mir-199-P2-v1_5p (mature (co-guide))
    23. Macaca mulatta (Rhesus monkey) mml-miR-199a-5p
    24. Macaca nemestrina (pig-tailed macaque) mne-miR-199a
    25. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-199-P3-v1_5p* (star (passenger))
    26. Mus musculus (house mouse) mmu-miR-199a-5p
    27. Ophiophagus hannah (king cobra) oha-miR-199c-5p
    28. Ornithorhynchus anatinus Oan-Mir-199-P3-v1_5p* (star (passenger))
    29. Oryctolagus cuniculus (rabbit) ocu-miR-199a-5p
    30. Ovis aries miscellaneous RNA
    31. Pan paniscus ppa-miR-199a
    32. Pan troglodytes ptr-miR-199a-5p
    33. Petromyzon marinus (sea lamprey) pma-miR-199a-5p
    34. Pongo pygmaeus ppy-miR-199a
    35. Rattus norvegicus rno-miR-199a-5p
    36. Saguinus labiatus (red-chested mustached tamarin) sla-miR-199a
    37. Salmo salar ssa-miR-199a-5p
    38. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-199-P3-v1_5p* (star (passenger))
    39. Scyliorhinus torazame (cloudy catshark) Sto-Mir-199-P3-v1_5p* (star (passenger))
    40. Sus scrofa (pig) ssc-miR-199a-5p
    41. Taeniopygia guttata (zebra finch) Tgu-Mir-199-P3-v1_5p* (star (passenger))
    42. Takifugu rubripes fru-miR-199
    43. Tetraodon nigroviridis tni-miR-199
    44. Tor tambroides (Thai mahseer) miR-199-5p
    45. Tursiops truncatus miR-199a
    46. Xenopus tropicalis xtr-miR-199a-5p