Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-199-5p URS0000554A4F_7955

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Danio rerio. Annotated by 4 databases (ENA, MirGeneDB, RefSeq, miRBase). Described in 14 papers. Danio rerio (zebrafish) dre-miR-199-5p sequence is a product of miR-199-5p, miR-199, dre-miR-199-5p, mir199-3a, dre-miR-199, mir199-1a, mir199-2a genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CCCAGUGUUCAGACUACCUGUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 105 other species

    1. Alligator mississippiensis Ami-Mir-199-P2-v1_5p* (star (passenger))
    2. Anolis carolinensis Aca-Mir-199-P2-v1_5p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-199-P2-v1_5p* (star (passenger))
    4. Canis lupus familiaris (dog) Cfa-Mir-199-P2-v1_5p* (star (passenger))
    5. Capra hircus chi-miR-199a-5p
    6. Cavia porcellus cpo-miR-199-5p
    7. Cervus elaphus (red deer) cel-miR-199a-5p
    8. Chrysemys picta bellii Cpi-Mir-199-P2-v1_5p* (star (passenger))
    9. Columba livia cli-miR-199-5p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-199a
    11. Cyprinus carpio (common carp) ccr-miR-199-5p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-199-5p
    13. Echinops telfairi Ete-Mir-199-P2-v1_5p* (star (passenger))
    14. Equus caballus eca-miR-199a-5p
    15. Gallus gallus (chicken) gga-miR-199-5p
    16. Gorilla gorilla (western gorilla) ggo-miR-199a
    17. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-199a
    18. Homo sapiens (human) hsa-miR-199a-5p
    19. Ictalurus punctatus ipu-miR-199a-5p
    20. Lagothrix lagotricha (brown woolly monkey) lla-miR-199a
    21. Macaca mulatta mml-miR-199a-5p
    22. Macaca nemestrina mne-miR-199a
    23. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-199-P3-v1_5p* (star (passenger))
    24. Mus musculus mmu-miR-199a-5p
    25. Ophiophagus hannah oha-miR-199c-5p
    26. Ornithorhynchus anatinus Oan-Mir-199-P3-v1_5p* (star (passenger))
    27. Oryctolagus cuniculus ocu-miR-199a-5p
    28. Ovis aries (sheep) miscellaneous RNA
    29. Pan paniscus ppa-miR-199a
    30. Pan troglodytes (chimpanzee) ptr-miR-199a-5p
    31. Petromyzon marinus (sea lamprey) pma-miR-199a-5p
    32. Pongo pygmaeus ppy-miR-199a
    33. Rattus norvegicus rno-miR-199a-5p
    34. Saguinus labiatus sla-miR-199a
    35. Salmo salar ssa-miR-199a-5p
    36. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-199-P3-v1_5p* (star (passenger))
    37. Scyliorhinus torazame (cloudy catshark) Sto-Mir-199-P3-v1_5p* (star (passenger))
    38. Sus scrofa ssc-miR-199a-5p
    39. Taeniopygia guttata (zebra finch) Tgu-Mir-199-P3-v1_5p* (star (passenger))
    40. Takifugu rubripes fru-miR-199
    41. Tetraodon nigroviridis tni-miR-199
    42. Tor tambroides miR-199-5p
    43. Tursiops truncatus miR-199a
    44. Xenopus tropicalis xtr-miR-199a-5p