Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-23a URS00005540D2_9925

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Capra hircus. Annotated by 3 databases (ENA, miRBase, RefSeq). Capra hircus (goat) chi-miR-23a sequence is a product of chi-miR-23a, miR-23, MIR23A, miR-23a, 23a, 23 genes. Found in the goat reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AUCACAUUGCCAGGGAUUUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Anolis carolinensis (green anole) aca-miR-23a-3p
    2. Ateles geoffroyi age-miR-23a
    3. Cervus elaphus (red deer) cel-miR-23a
    4. Chrysemys picta cpi-miR-23a-3p
    5. Cricetulus griseus cgr-miR-23a-3p
    6. Cyprinus carpio ccr-miR-23a
    7. Equus caballus (horse) eca-miR-23a
    8. Gorilla gorilla (western gorilla) ggo-miR-23a
    9. Homo sapiens hsa-miR-23a-3p
    10. Ictalurus punctatus ipu-miR-23a
    11. Lemur catta (Ring-tailed lemur) lca-miR-23a
    12. Lepisosteus oculatus (spotted gar) Loc-Mir-23-P1_3p (mature (guide))
    13. Macaca mulatta (Rhesus monkey) mml-miR-23a-3p
    14. Macaca nemestrina (pig-tailed macaque) mne-miR-23a
    15. Mus musculus mmu-miR-23a-3p
    16. Ovis aries miscellaneous RNA
    17. Pan paniscus ppa-miR-23a
    18. Pan troglodytes (chimpanzee) ptr-miR-23a
    19. Papio hamadryas (hamadryas baboon) pha-miR-23a
    20. Pongo pygmaeus (Bornean orangutan) ppy-miR-23a
    21. Pundamilia nyererei pny-miR-23a
    22. Python bivittatus pbv-miR-23a-3p
    23. Rattus norvegicus rno-miR-23a-3p
    24. Saguinus labiatus sla-miR-23a
    25. Salmo salar ssa-miR-23a-3p
    26. Sus scrofa (pig) ssc-miR-23a
    27. Tursiops truncatus (common bottlenose dolphin) miR-23a
    28. Xenopus laevis xla-miR-23a
    29. Xenopus tropicalis xtr-miR-23a
    Publications New