Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-23a URS00005540D2_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-23a: Ssc-mir-23a is a microRNA (miRNA) that has been identified in several studies. It is one of the differentially expressed (DE) miRNAs in M pig, with 199, 127, 140, and 37 DE miRNAs identified in different comparisons [PMC4890935]. The ssc-mir-23a promoter has been used to construct luciferase reporters for functional studies [PMC9219974]. It has been found to be one of the dominant expressed miRNAs in the F3 library and is expressed in various pig tissues [PMC3901342] [PMC3427155]. The sequence for ssc-mir-23a described in the miRBase database has been found multiple times [PMC3555835]. It is one of the most abundant miRNAs in porcine kidney and shows differential expression patterns across different populations [PMC3555835]. Variants of ssc-mir-23a have been associated with regulatory pathways and have shown significant associations with putative mRNA targets [PMC8097994]. Additionally, ssc-mir-23a has been found to be highly expressed in the anterior pituitary gland [PMC4489742]. References: [PMC4890935] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4890935/ [PMC9219974] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9219974/ [PMC3901342] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3901342/ [PMC3427155] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3427155/ [PM3555835] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM3555835/ [PM8097994] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM8097994/ [PMC4489742] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4489742/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACAUUGCCAGGGAUUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Anolis carolinensis aca-miR-23a-3p
  2. Ateles geoffroyi age-miR-23a
  3. Capra hircus (goat) chi-miR-23a
  4. Cervus elaphus cel-miR-23a
  5. Chrysemys picta (Painted turtle) cpi-miR-23a-3p
  6. Cricetulus griseus cgr-miR-23a-3p
  7. Cyprinus carpio ccr-miR-23a
  8. Equus caballus eca-miR-23a
  9. Gorilla gorilla gorilla ggo-miR-23a (MIR23A)
  10. Gorilla gorilla (western gorilla) ggo-miR-23a
  11. Homo sapiens hsa-miR-23a-3p
  12. Ictalurus punctatus ipu-miR-23a
  13. Lemur catta (Ring-tailed lemur) lca-miR-23a
  14. Lepisosteus oculatus (spotted gar) Loc-Mir-23-P1_3p (mature (guide))
  15. Macaca mulatta (Rhesus monkey) mml-miR-23a-3p
  16. Macaca nemestrina (pig-tailed macaque) mne-miR-23a
  17. Mus musculus (house mouse) mmu-miR-23a-3p
  18. Ovis aries (sheep) miscellaneous RNA
  19. Pan paniscus ppa-miR-23a
  20. Pan troglodytes ptr-miR-23a
  21. Papio hamadryas pha-miR-23a
  22. Pongo pygmaeus (Bornean orangutan) ppy-miR-23a
  23. Pundamilia nyererei pny-miR-23a
  24. Python bivittatus (Burmese python) pbv-miR-23a-3p
  25. Rattus norvegicus rno-miR-23a-3p
  26. Saguinus labiatus sla-miR-23a
  27. Salmo salar ssa-miR-23a-3p
  28. Tursiops truncatus (common bottlenose dolphin) miR-23a
  29. Xenopus laevis xla-miR-23a
  30. Xenopus tropicalis xtr-miR-23a
Publications