Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-23a-3p URS00005540D2_10090

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Mus musculus. Annotated by 6 databases (TarBase, miRBase, ENA, RefSeq, LncBase, PirBase). Described in 48 papers. Mus musculus (house mouse) mmu-miR-23a-3p sequence is a product of miR-23a, 23, 23a, Mir23a, miR-23, miR-23a-3p, mmu-miR-23a, mmu-miR-23a-3p genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610008P16Rik, 0610010G05Rik, 0610025L06Rik, 0610030A03Rik, 0610030G24Rik, 0610038L10Rik, 0610043A03Rik, 0710008J23Rik, 0710008N11Rik, 0910001K20Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUCACAUUGCCAGGGAUUUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 57 other species

    1. Anolis carolinensis aca-miR-23a-3p
    2. Ateles geoffroyi (black-handed spider monkey) age-miR-23a
    3. Capra hircus chi-miR-23a
    4. Cervus elaphus (red deer) cel-miR-23a
    5. Chrysemys picta cpi-miR-23a-3p
    6. Cricetulus griseus (Chinese hamster) cgr-miR-23a-3p
    7. Cyprinus carpio (common carp) ccr-miR-23a
    8. Equus caballus eca-miR-23a
    9. Gorilla gorilla (western gorilla) ggo-miR-23a
    10. Homo sapiens (human) hsa-miR-23a-3p
    11. Ictalurus punctatus ipu-miR-23a
    12. Lemur catta lca-miR-23a
    13. Macaca mulatta mml-miR-23a-3p
    14. Macaca nemestrina mne-miR-23a
    15. Ovis aries (sheep) miscellaneous RNA
    16. Pan paniscus ppa-miR-23a
    17. Pan troglodytes (chimpanzee) ptr-miR-23a
    18. Papio hamadryas pha-miR-23a
    19. Pongo pygmaeus ppy-miR-23a
    20. Pundamilia nyererei pny-miR-23a
    21. Python bivittatus pbv-miR-23a-3p
    22. Rattus norvegicus rno-miR-23a-3p
    23. Saguinus labiatus sla-miR-23a
    24. Salmo salar ssa-miR-23a-3p
    25. Sus scrofa ssc-miR-23a
    26. Tursiops truncatus miR-23a
    27. Xenopus laevis xla-miR-23a
    28. Xenopus tropicalis xtr-miR-23a