Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6715a-3p URS0000552FF1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6715a: Hsa-mir-6715a, a novel microRNA (miRNA), was detected in the analysis [PMC4162537]. Although it was not included in miRBase release 18, it was later included in subsequent releases, indicating the reliability of the strategy used to identify novel miRNAs [PMC4162537]. Zhang & Ge (2019) found a relationship between hsa-mir-6715a and cholangiocarcinoma [PMC9248787]. In a study, hsa-mir-6715a was chosen along with hsa-mir-1295b and hsa-mir-33b to build a ceRNA network [PMC6451803]. However, no reports related to cancer and hsa-mir-6715a were identified [PMC6451803]. Hsa-mir-6715a, along with other miRNAs and lncRNAs, were found to be correlated in the study [PMC6451803]. In another analysis, hsa-mir-1266, hsa-mir-1295b, hsa-mir-33b, hsa-mir-551b, and hsa-mir-6715a were identified as prognostic DEmiRNAs in addition to other lncRNAs and mRNAs [PMC6451803]. The study demonstrated that low-expression levels of hsa-miR33b, hasmiR1295b,and hasmiR6715awere associated with poor overall survival (OS) in cholangiocarcinoma patients. These miRNAs were suggested as potential therapeutic targets that require further research [PMC6451803].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAAACCAGUCGUGCCUGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications