Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-210-3p URS000055128B_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, MalaCards, PSICQUIC, RefSeq, LncBase, MirGeneDB, miRBase, TarBase, GeneCards). Described in 80 papers. Homo sapiens (human) hsa-miR-210-3p sequence is a product of hsa-miR-210-3p, MIR210, miR-210-3p, miR-210, hsa-miR-210 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8U, 13CDNA73, 15.5K, 170A, 18A2, 2-21, 2C4D, 2H9, 2HOR0202, 3'HEXO.

Interactions 30

According to PSICQUIC, Homo sapiens (human) hsa-miR-210-3p interacts with:

Interaction id Participant Synonyms
URS000055128B_9606-0 O00716 O00716
URS000055128B_9606-17 O00716 O00716
URS000055128B_9606-1 P07237 P07237
URS000055128B_9606-2 P14061 P14061
URS000055128B_9606-18 P14061 P14061
URS000055128B_9606-3 P23560 P23560
URS000055128B_9606-4 P31269 P31269
URS000055128B_9606-19 P31269 P31269
URS000055128B_9606-5 P43351 P43351
URS000055128B_9606-20 P43351 P43351
URS000055128B_9606-21 P49639 P49639
URS000055128B_9606-6 P49639 P49639
URS000055128B_9606-9 P52797 P52797
URS000055128B_9606-16 P52797 P52797
URS000055128B_9606-22 P52797 P52797
URS000055128B_9606-23 P52797 P52797
URS000055128B_9606-24 P52797 P52797
URS000055128B_9606-25 P52797 P52797
URS000055128B_9606-7 P52797 P52797
URS000055128B_9606-8 P52797 P52797
URS000055128B_9606-26 Q15818 Q15818
URS000055128B_9606-10 Q15818 Q15818
URS000055128B_9606-11 Q8N335 Q8N335
URS000055128B_9606-12 Q8N441 Q8N441
URS000055128B_9606-13 Q8N441 Q8N441
URS000055128B_9606-28 Q8N441 Q8N441
URS000055128B_9606-27 Q8N441 Q8N441
URS000055128B_9606-14 Q9H1K1 Q9H1K1
URS000055128B_9606-15 Q9UKL3 Q9UKL3
URS000055128B_9606-29 Q9UKL3 Q9UKL3

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGUGCGUGUGACAGCGGCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Bos taurus (cattle) Bta-Mir-210_3p (mature (guide))
    2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-210-5p
    3. Branchiostoma floridae bfl-miR-210-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-210_3p (mature (guide))
    5. Capra hircus miR-210
    6. Cavia porcellus cpo-miR-210-3p
    7. Cricetulus griseus (Chinese hamster) cgr-miR-210-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-210-3p
    9. Echinops telfairi Ete-Mir-210_3p (mature (guide))
    10. Gorilla gorilla (western gorilla) ggo-miR-210
    11. Macaca mulatta mml-miR-210-3p
    12. Mus musculus mmu-miR-210-3p
    13. Nomascus leucogenys nle-miR-210
    14. Oryctolagus cuniculus Ocu-Mir-210_3p (mature (guide))
    15. Otolemur garnettii oga-miR-210
    16. Ovis aries (sheep) miscellaneous RNA
    17. Pan paniscus ppa-miR-210
    18. Pan troglodytes (chimpanzee) ptr-miR-210
    19. Papio hamadryas pha-miR-210
    20. Rattus norvegicus rno-miR-210-3p
    21. Sus scrofa ssc-miR-210
    22. Tupaia chinensis (Chinese tree shrew) tch-miR-210