Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-210-3p URS000055128B_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-210: Rno-mir-210 is a microRNA that has been studied in various contexts [PMC4636775]. Real-time quantitative PCR was used to analyze the expression of rno-mir-210, along with other genes, in a study [PMC4265493]. In another study, adult rat cardiomyocytes were transfected with rno-mir-210 and cultured for one week [PMC8066105]. The transfection was done using Lipofectamine RNAiMAX reagent [PMC8066105]. Rno-mir-210, along with rno-miR-378, was found to regulate hub genes Fos and Serpine1 in acute kidney injury (AKI), affecting inflammation and cell apoptosis [PMC6625446]. Additionally, five miRNAs (rno-miR-378, rno-mir-210, rno-miR-99a*, rno-miR-146b, and rno-miR132) were differentially expressed in the AKI model group compared to the control group and were reversed following mesenchymal stem cell (MSC) treatment [PMC6625446]. Furthermore, three miRNAs (rno-miR378, rnomir210,andrnomiR99a*) were found to be common between the downregulated differentially expressed miRNAs in the AKI group and the upregulated differentially expressed miRNAs in the MSC treatment group [PMC6625446].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUGCGUGUGACAGCGGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus (cattle) Bta-Mir-210_3p (mature (guide))
  2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-210-5p
  3. Branchiostoma floridae bfl-miR-210-3p
  4. Branchiostoma lanceolatum Bla-Mir-210_3p (mature (guide))
  5. Canis lupus familiaris (dog) Cfa-Mir-210_3p (mature (guide))
  6. Capra hircus (goat) miR-210
  7. Cavia porcellus cpo-miR-210-3p
  8. Cricetulus griseus cgr-miR-210-3p
  9. Dasypus novemcinctus dno-miR-210-3p
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-210_3p (mature (guide))
  11. Gorilla gorilla gorilla ggo-miR-210 (MIR210)
  12. Gorilla gorilla (western gorilla) ggo-miR-210
  13. Homo sapiens hsa-miR-210-3p
  14. Macaca mulatta (Rhesus monkey) mml-miR-210-3p
  15. Mus musculus (house mouse) mmu-miR-210-3p
  16. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-210
  17. Oryctolagus cuniculus (rabbit) Ocu-Mir-210_3p (mature (guide))
  18. Otolemur garnettii (small-eared galago) oga-miR-210
  19. Ovis aries (sheep) miscellaneous RNA
  20. Pan paniscus ppa-miR-210
  21. Pan troglodytes ptr-miR-210
  22. Papio hamadryas pha-miR-210
  23. Sus scrofa ssc-miR-210
  24. Tupaia chinensis (Chinese tree shrew) tch-miR-210
Publications