Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-210-3p URS000055128B_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 8 databases (ENA, PSICQUIC, RefSeq, LncBase, PirBase, MirGeneDB, miRBase, TarBase). Described in 48 papers. Mus musculus (house mouse) mmu-miR-210-3p sequence is a product of mmu-miR-210-3p, miR-210-3p, mmu-miR-210, Mir210, miR-210 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610025H04Rik, 0610035N01Rik, 0610039G24Rik, 1100001I22Rik, 1110001A17Rik, 1110003E01Rik, 1110003F05Rik, 1110003P16Rik, 1110005P14Rik, 1110006F08Rik.

Interactions 2

According to PSICQUIC, Mus musculus (house mouse) mmu-miR-210-3p interacts with:

Interaction id Participant Synonyms
URS000055128B_10090-0 P21237 P21237
URS000055128B_10090-1 P21237 P21237

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGUGCGUGUGACAGCGGCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Bos taurus (cattle) Bta-Mir-210_3p (mature (guide))
    2. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-210-5p
    3. Branchiostoma floridae bfl-miR-210-3p
    4. Canis lupus familiaris (dog) Cfa-Mir-210_3p (mature (guide))
    5. Capra hircus miR-210
    6. Cavia porcellus cpo-miR-210-3p
    7. Cricetulus griseus (Chinese hamster) cgr-miR-210-3p
    8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-210-3p
    9. Echinops telfairi Ete-Mir-210_3p (mature (guide))
    10. Gorilla gorilla (western gorilla) ggo-miR-210
    11. Homo sapiens (human) hsa-miR-210-3p
    12. Macaca mulatta mml-miR-210-3p
    13. Nomascus leucogenys nle-miR-210
    14. Oryctolagus cuniculus Ocu-Mir-210_3p (mature (guide))
    15. Otolemur garnettii oga-miR-210
    16. Ovis aries (sheep) miscellaneous RNA
    17. Pan paniscus ppa-miR-210
    18. Pan troglodytes (chimpanzee) ptr-miR-210
    19. Papio hamadryas pha-miR-210
    20. Rattus norvegicus rno-miR-210-3p
    21. Sus scrofa ssc-miR-210
    22. Tupaia chinensis (Chinese tree shrew) tch-miR-210