Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-659-5p URS000054DF42_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-659: Hsa-mir-659 is a non-regulated microRNA that has been investigated in cell lines and has been shown to influence the risk of dementia [PMC4222942] [PMC3448685]. The joint contribution of H1F0 and hsa-mir-659 on the risk of dementia is a topic that may require further attention [PMC3448685]. It is possible that the detected interactions between HLA-DPB1 and hsa-mir-219-1, as well as between H1F0 and hsa-mir-659, may be tagging for other complex haplotypic effects spanning a large distance and involving several genes [PMC3448685]. Two interactions involving miSNPs × 3utrSNPs have been robustly identified, one involving HLA-DPB1 rs1042448 and hsa-mir-219-1 rs107822, and the other involving H1F0 rs1894644 and hsa-mir-659 rs5750504 [PMC3448685]. In a study on Burkitt lymphoma cases, it was found that hsa-mir-659 differentiated cases based on Epstein-Barr virus (EBV) status, while 21 EBV-encoded miRNAs were differentially expressed in the two categories [PMC4807994]. Additionally, hsa-mir-659 was found to be part of a predictive signature for recurrence-free survival (RFS) in another study [PMC9221286] [PMC6682788]. It was classified as a predictive miRNA (PRdmiR) in one study but classified as non-responsive (NRdmiR) in another study [PMC3059204]. The folding energy of the interaction between hsa-miR-185* and TrkB-T1 3′UTR was estimated to be similar to other microRNA interactions investigated [PMC3382618]. According to miRBase annotation, hsa-mir-659 encodes a mature miRNA at its 3p arm [PMC3303722].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGACCUUCCCUGAACCAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications