Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 83A (SNORD83A) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 83A (SNORD83A) URS000054DD16_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD83A: SNORD83A is a C/D box snoRNA that has been found to be significant in various types of cancer, including head and neck squamous cell carcinoma (HNSC), pheochromocytoma and paraganglioma (PCPG), lung squamous cell carcinoma (LUSC), and pancreatic adenocarcinoma (PAAD) [PMC6294694]. It is one of the snoRNAs that lack well-confirmed target sites on ribosomal RNAs and snRNAs [PMC4914119]. SNORD83A has been detected in exosomes, showing more than a 2-fold enrichment [PMC4615768]. It has also been found to be upregulated in breast cancer samples [PMC9803687]. SNORD83A, along with SNORD66 and SNORD78, has been shown to be cooperative for the early detection of non-small cell lung cancer (NSCLC) with high sensitivity and specificity [PMC9005336]. Additionally, plasma SNORD83A has been associated with tumor size in NSCLC patients [PMC9005336]. In CHIKV-infected cells, SNORD83A was found to be upregulated at 12 and 24 hours post-infection [PMC9967650]. References: - PMC6294694 - PMC4914119 - PMC4615768 - PMC9803687 - PMC9005336 - PMC9967650

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUGUUCGUUGAUGAGGCUCAGAGUGAGCGCUGGGUACAGCGCCCGAAUCGGACAGUGUAGAACCAUUCUCUACUGCCUUCCUUCUGAGAACAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications