Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR171j-3p URS000054D5EF_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (ENA, miRBase, RefSeq). Zea mays zma-miR171j-3p sequence is a product of miR171, zma-miR171i-3p, MIR171i, zma-miR171d, zma-miR171e, miR171e-3p, miR171j-3p, zma-miR171j-3p, miR171i, miR171j, miR171d-3p, miR171e, MIR171j, zma-miR171e-3p, miR171i-3p, miR171d, zma-miR171i, MIR171e, MIR171d, zma-miR171d-3p, zma-miR171j genes. Found in the Zea mays reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGAUUGAGCCGUGCCAAUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Aegilops tauschii ata-miR171b-3p
    2. Ananas comosus miR171b
    3. Aquilegia coerulea aqc-miR171a
    4. Arabidopsis thaliana (thale cress) Ath_wt_10678
    5. Asparagus officinalis (garden asparagus) aof-miR171a
    6. Brachypodium distachyon bdi-miR171b
    7. Carica papaya (papaya) cpa-miR171d
    8. Citrus reticulata crt-miR171
    9. Citrus sinensis (sweet orange) csi-miR171c-3p
    10. Corchorus capsularis sRNA CCACVL1_09127
    11. Corchorus olitorius aly-miR170-
    12. Cucumis melo (muskmelon) cme-miR171c
    13. Fragaria vesca subsp. vesca fve-miR171g
    14. Glycine max gma-miR171e
    15. Helianthus annuus sRNA HannXRQ_Chr09g0256995
    16. Helianthus paradoxus hpa-miR171a
    17. Helianthus tuberosus htu-miR171b
    18. Hordeum vulgare hvu-miR171-3p
    19. Linum usitatissimum (flax) lus-miR171b
    20. Lolium arundinaceum far-miR171
    21. Lotus japonicus lja-miR171a
    22. Malus domestica mdm-miR171g
    23. Manihot esculenta (cassava) mes-miR171j
    24. Medicago truncatula mtr-miR171d
    25. Nicotiana tabacum (common tobacco) nta-miR171c
    26. Oryza sativa Japonica Group microRNA osa-miR171d-3p
    27. Oryza sativa osa-miR171e-3p
    28. Pinus densata pde-miR171
    29. Populus tomentosa Pto-miR171e
    30. Populus trichocarpa (black cottonwood) ptc-miR171h-3p
    31. Prunus persica ppe-miR171c
    32. Ricinus communis rco-miR171f
    33. Rosa chinensis osa-miR171b
    34. Solanum lycopersicum sly-miR171a
    35. Solanum tuberosum stu-miR171e
    36. Sorghum bicolor sbi-miR171a
    37. Theobroma cacao (cacao) tcc-miR171d
    38. Triticum aestivum (bread wheat) tae-miR171a
    39. Vitis vinifera (wine grape) vvi-miR171c
    Publications New