Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR171d-3p URS000054D5EF_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR171d-3p sequence is a product of miR171f, osa-miR171c, miR171e-3p, osa-miR171f-3p, miR171b, osa-miR171b, osa-miR171d, osa-miR171e, miR171d, miR171, miR171c-3p, osa-miR171d-3p, osa-miR171c-3p, miR171d-3p, osa-miR171e-3p, miR171c, miR171f-3p, osa-miR171f, miR171e genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAUUGAGCCGUGCCAAUAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 64 other species

    1. Aegilops tauschii ata-miR171b-3p
    2. Ananas comosus miR171b
    3. Aquilegia coerulea aqc-miR171a
    4. Arabidopsis thaliana Ath_wt_10678
    5. Asparagus officinalis aof-miR171a
    6. Brachypodium distachyon bdi-miR171b
    7. Carica papaya (papaya) cpa-miR171b
    8. Citrus reticulata crt-miR171
    9. Citrus sinensis (sweet orange) csi-miR171f-3p
    10. Corchorus capsularis (jute) sRNA CCACVL1_09127
    11. Corchorus olitorius aly-miR170-
    12. Cucumis melo cme-miR171f
    13. Fragaria vesca subsp. vesca fve-miR171d
    14. Glycine max (soybean) gma-miR171u
    15. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr09g0256995
    16. Helianthus paradoxus hpa-miR171a
    17. Helianthus tuberosus htu-miR171b
    18. Hordeum vulgare hvu-miR171-3p
    19. Linum usitatissimum (flax) lus-miR171e
    20. Lolium arundinaceum far-miR171
    21. Lotus japonicus lja-miR171a
    22. Malus domestica mdm-miR171g
    23. Manihot esculenta (cassava) mes-miR171h
    24. Medicago truncatula mtr-miR171d
    25. Nicotiana tabacum (common tobacco) nta-miR171c
    26. Oryza sativa (rice) osa-miR171e-3p
    27. Pinus densata pde-miR171
    28. Populus tomentosa Pto-miR171e
    29. Populus trichocarpa (black cottonwood) ptc-miR171e
    30. Prunus persica ppe-miR171a
    31. Ricinus communis (castor bean) rco-miR171c
    32. Rosa chinensis osa-miR171b
    33. Solanum lycopersicum (tomato) sly-miR171a
    34. Solanum tuberosum stu-miR171a-3p
    35. Sorghum bicolor (sorghum) sbi-miR171a
    36. Theobroma cacao tcc-miR171d
    37. Triticum aestivum (bread wheat) tae-miR171a
    38. Vitis vinifera (wine grape) vvi-miR171i
    39. Zea mays zma-miR171j-3p