Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR444d.2 URS0000547E52_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR444a-3p.2: osa-mir444a-3p.2 is a miRNA that has been implicated in Al stress responses [PMC6069884]. In a study comparing two different varieties of barley, XZ29 and Golden Promise, osa-mir444a-3p.2 was found to be down-regulated in XZ29 and showed little change in Golden Promise [PMC6069884]. The target gene of osa-mir444a-3p.2, HORVU2Hr1G08490.1 (MADS27), was up-regulated in both XZ29 and Golden Promise [PMC6069884]. In another study using a weighted gene co-expression network analysis (WGCNA), osa-mir444a-3p.2 was identified as one of the miRNAs targeted by potential drought-resistant hub genes (MADS47, CCX1, carC, PAO2, and HOX24) [PMC9433978]. This analysis also revealed that osa-mir444a-3p.2 was differentially expressed in A. mongolicum under drought stress and predicted to regulate MADS47 target genes [PMC9433978]. Furthermore, osa-mir444a-3p.2 was found to be one of the miRNAs targeting members of the OsHDZIP subfamily III [PMC9405480]. Additionally, it was observed that osa-mir444a-3p.2 was up-regulated by 4–6 fold under certain conditions [PMC6042804]. Overall, these findings suggest that osa-mir444a-3p.2 may play a role in Al stress responses and drought resistance through its regulation of target genes such as MADS27 and members of the OsHDZIP subfamily III.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGUUGCUGCCUCAAGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Ananas comosus microRNA 444e
  2. Brachypodium distachyon (stiff brome) bdi-miR444b
  3. Hordeum vulgare microRNA444.1a2
  4. Oryza sativa Japonica Group microRNA osa-miR444d.2
Publications