Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-184 URS0000543D82_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-184: Bta-mir-184 is a miRNA that has been found to be differentially expressed in various studies. It has been detected in bovine mammary epithelial cells challenged with heat-inactivated E. coli and S. aureus bacteria [PMC4585011]. It is also expressed during E. coli infection, while other miRNAs, such as bta-mir-2339, miR-499, miR-23a, and miR-99b, are specific to S. aureus infection [PMC9539446]. Bta-mir-184 has been detected in both control and S. aureus infected groups [PMC5821052]. It has also been found to have different binding capacity with haplotypes in NY cattle [PMC7824473]. Bta-mir-184 is upregulated in EVs from good-quality embryos and may block cell functions required for normal embryo development [PMC7727673]. It is also associated with bovine embryo competence [PMC7727673]. Bta-mir-184 expression levels have been found to be increased during yak testicular development and spermatogenesis [PMC9940382]. In infected compartments, bta-mir-184 expression is upregulated compared to the control group [PMC4840452]. Bta-mir-184 has also been detected in the culture medium of bovine embryos and is related to embryo competence [PMC5617439]. In addition, bta-mir-184 is expressed specifically in rumen and gut tissues of cattle [PMC6371894]. Overall, bta-mir-184 plays a significant role in various biological processes related to infection response, embryonic development, testicular development, and gut tissue specificity.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-184-3p
  2. Anolis carolinensis aca-miR-184-3p
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
  4. Canis lupus familiaris (dog) cfa-miR-184
  5. Capra hircus chi-miR-184
  6. Cavia porcellus cpo-miR-184-3p
  7. Cervus elaphus (red deer) cel-miR-184
  8. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
  9. Chrysemys picta (Painted turtle) cpi-miR-184-3p
  10. Columba livia (rock pigeon) cli-miR-184-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-184
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-184-3p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-184_3p (mature (guide))
  14. Equus caballus eca-miR-184
  15. Gallus gallus gga-miR-184-3p
  16. Gekko japonicus Gja-Mir-184_3p (mature (guide))
  17. Homo sapiens (human) hsa-miR-184
  18. Macaca mulatta (Rhesus monkey) mml-miR-184
  19. Macaca nemestrina mne-miR-184
  20. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
  21. Monopterus albus (swamp eel) Mal-Mir-184-P1_3p (mature (guide))
  22. Mus musculus (house mouse) mmu-miR-184-3p
  23. Oryctolagus cuniculus ocu-miR-184-3p
  24. Otolemur garnettii (small-eared galago) oga-miR-184
  25. Pan troglodytes ptr-miR-184
  26. Pongo pygmaeus ppy-miR-184
  27. Pteropus alecto pal-miR-184-3p
  28. Python bivittatus Pbv-Mir-184_3p (mature (guide))
  29. Rattus norvegicus (Norway rat) rno-miR-184
  30. Sarcophilus harrisii Sha-Mir-184_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-184_3p (mature (guide))
  32. Sus scrofa ssc-miR-184
  33. Taeniopygia guttata (zebra finch) tgu-miR-184
  34. Tupaia chinensis (Chinese tree shrew) tch-miR-184
Publications