Caution, this is an AI generated summary based on literature. This may have errors, see here for more.
Please share your feedback with us.
mmu-mir-184: Mmu-mir-184 is a specific type of microRNA that was used in a study conducted in Japan [PMC3792180]. The sequence of mmu-mir-184 is provided as "Sence: uggacggagaacugauaagggu, Anti-sence: ccuuaucaguucuccguccagc" [PMC3792180]. In another study, mmu-mir-184 was identified as one of the top 10 microRNAs enriched in the terminal end-buds or mature ducts of the pubertal murine mammary glands [PMC8944794]. It was found to be expressed in all five stages of development along with other microRNAs [PMC8944794]. The annotation of mmu-mir-184 is challenging due to its reads mapping to only one arm, making it difficult to determine its accuracy based on reads alone [PMC3965103]. In a different study, it was observed that mmu-mir-184 potentially regulates Hmgcs2, which encodes an enzyme with hydroxymethylglutaryl-CoA synthase activity [PMC3692539]. Additionally, six miRNAs including mmu-mir-184 were found to have reduced expression in an A-Myb mutant and were associated with an A-MYB binding peak nearby [PMC8514520].
References:
[PMC3792180]
[PMC8944794]
[PMC3965103]
[PMC3692539]
[PMC8514520]
Genome locations
Gene Ontology annotations
Ancestor Chart
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset