Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-184 URS0000543D82_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-184: Ssc-mir-184 is a downregulated microRNA during follicle atresia [PMC4522283]. It is also found to be downregulated in cases of goose fatty liver [PMC8630403]. In follicle atresia, several other microRNAs are also downregulated, including R-let-7a, hsa-let-7i, hsa-miR-92b, hsa-miR-92a, P-miR-923, hsa-miR-1979, R-miR-739, hsa-miR-1308, hsa-miR-1826 [PMC4522283]. In addition to its role in follicle atresia and goose fatty liver, ssc-mir-184 has been found to be involved in the regulation of pathogenicity-related signaling pathways [PMC7820490]. It has been shown to competitively bind with other microRNAs such as ssc-mir4905p and ssc-mir216 [PMC6458635]. Furthermore, ssc_mir184 has been predicted to have high scores and free energy according to the miRNA prediction results of miRanda [PMC5933978]. The expression of ssc_mir184 is significantly increased in cases of goose fatty liver compared to normal liver tissue [PMC8630403]. Overall, ssc_mir184 plays a role in various biological processes and its dysregulation is associated with follicle atresia and fatty liver disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-184-3p
  2. Anolis carolinensis aca-miR-184-3p
  3. Bos taurus (cattle) bta-miR-184
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
  5. Canis lupus familiaris (dog) cfa-miR-184
  6. Capra hircus chi-miR-184
  7. Cavia porcellus cpo-miR-184-3p
  8. Cervus elaphus (red deer) cel-miR-184
  9. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-184-3p
  11. Columba livia (rock pigeon) cli-miR-184-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-184
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-184-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-184_3p (mature (guide))
  15. Equus caballus eca-miR-184
  16. Gallus gallus gga-miR-184-3p
  17. Gekko japonicus Gja-Mir-184_3p (mature (guide))
  18. Homo sapiens (human) hsa-miR-184
  19. Macaca mulatta (Rhesus monkey) mml-miR-184
  20. Macaca nemestrina mne-miR-184
  21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
  22. Monopterus albus (swamp eel) Mal-Mir-184-P1_3p (mature (guide))
  23. Mus musculus (house mouse) mmu-miR-184-3p
  24. Oryctolagus cuniculus ocu-miR-184-3p
  25. Otolemur garnettii (small-eared galago) oga-miR-184
  26. Pan troglodytes ptr-miR-184
  27. Pongo pygmaeus ppy-miR-184
  28. Pteropus alecto pal-miR-184-3p
  29. Python bivittatus Pbv-Mir-184_3p (mature (guide))
  30. Rattus norvegicus (Norway rat) rno-miR-184
  31. Sarcophilus harrisii Sha-Mir-184_3p (mature (guide))
  32. Sphenodon punctatus Spt-Mir-184_3p (mature (guide))
  33. Taeniopygia guttata (zebra finch) tgu-miR-184
  34. Tupaia chinensis (Chinese tree shrew) tch-miR-184
Publications