Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-184 URS0000543D82_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-184: Rno-mir-184 is a microRNA that has been found to be associated with heart failure (HF) and the development of thecal hyperandrogenesis [PMC4978447] [PMC3682887]. In a study on failing myocardium, rno-mir-184 was identified as one of the most significantly differentially expressed miRNAs between HF and control groups [PMC4978447]. Additionally, rno-mir-184 was found to be upregulated during the development of heart failure [PMC4978447]. In another study, rno-mir-184 was significantly higher in LNCs (luteinized granulosa cells) compared to 3T3 cells [PMC9398820]. Furthermore, rno-mir-184 was dysregulated in GHS (growth hormone secretagogue) rats and showed one of the largest positive fold changes in expression compared to control rats [PMC4824905]. The downregulation of rno-mir-184 has also been associated with promoted thecal hyperandrogenesis [PMC3682887]. Additionally, rno-mir-184 has been identified as one of the most abundantly upregulated miRNAs in prostate tissues when comparing different conditions such as CAR (castration-resistant prostate cancer) versus BC (benign prostate hyperplasia) and CAR versus NS (normal prostate tissues) [PMC6628738]. Overall, these studies highlight the potential role of rno-mir-184 in various physiological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGACGGAGAACUGAUAAGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-184-3p
  2. Anolis carolinensis aca-miR-184-3p
  3. Bos taurus (cattle) bta-miR-184
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
  5. Canis lupus familiaris (dog) cfa-miR-184
  6. Capra hircus chi-miR-184
  7. Cavia porcellus cpo-miR-184-3p
  8. Cervus elaphus (red deer) cel-miR-184
  9. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-184-3p
  11. Columba livia (rock pigeon) cli-miR-184-3p
  12. Cricetulus griseus (Chinese hamster) cgr-miR-184
  13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-184-3p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-184_3p (mature (guide))
  15. Equus caballus eca-miR-184
  16. Gallus gallus gga-miR-184-3p
  17. Gekko japonicus Gja-Mir-184_3p (mature (guide))
  18. Homo sapiens (human) hsa-miR-184
  19. Macaca mulatta (Rhesus monkey) mml-miR-184
  20. Macaca nemestrina mne-miR-184
  21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
  22. Monopterus albus (swamp eel) Mal-Mir-184-P1_3p (mature (guide))
  23. Mus musculus (house mouse) mmu-miR-184-3p
  24. Oryctolagus cuniculus ocu-miR-184-3p
  25. Otolemur garnettii (small-eared galago) oga-miR-184
  26. Pan troglodytes ptr-miR-184
  27. Pongo pygmaeus ppy-miR-184
  28. Pteropus alecto pal-miR-184-3p
  29. Python bivittatus Pbv-Mir-184_3p (mature (guide))
  30. Sarcophilus harrisii Sha-Mir-184_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-184_3p (mature (guide))
  32. Sus scrofa ssc-miR-184
  33. Taeniopygia guttata (zebra finch) tgu-miR-184
  34. Tupaia chinensis (Chinese tree shrew) tch-miR-184
Publications