Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-184-3p URS0000543D82_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, LncBase, ENA, TarBase, PirBase, MirGeneDB, miRBase). Mus musculus (house mouse) mmu-miR-184-3p sequence is a product of mmu-miR-184-3p, Mir184, mmu-miR-184, miR-184-3p, miR-184, 184 genes. Found in the house mouse reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including Ctbp2, D7Ertd45e, ENSMUSG00000030970, Gtrgeo6, Ribeye.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGGACGGAGAACUGAUAAGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 34 other species

    1. Alligator mississippiensis (American alligator) ami-miR-184-3p
    2. Anolis carolinensis (green anole) aca-miR-184-3p
    3. Bos taurus bta-miR-184
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
    5. Canis lupus familiaris (dog) cfa-miR-184
    6. Capra hircus chi-miR-184
    7. Cavia porcellus (domestic guinea pig) cpo-miR-184-3p
    8. Cervus elaphus (red deer) cel-miR-184
    9. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
    10. Chrysemys picta cpi-miR-184-3p
    11. Columba livia cli-miR-184-3p
    12. Cricetulus griseus cgr-miR-184
    13. Dasypus novemcinctus dno-miR-184-3p
    14. Echinops telfairi Ete-Mir-184_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-184
    16. Gallus gallus (chicken) gga-miR-184-3p
    17. Gekko japonicus Gja-Mir-184_3p (mature (guide))
    18. Homo sapiens hsa-miR-184
    19. Macaca mulatta (Rhesus monkey) mml-miR-184
    20. Macaca nemestrina (pig-tailed macaque) mne-miR-184
    21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
    22. Monopterus albus (swamp eel) Mal-Mir-184-P1_3p (mature (guide))
    23. Oryctolagus cuniculus ocu-miR-184-3p
    24. Otolemur garnettii oga-miR-184
    25. Pan troglodytes (chimpanzee) ptr-miR-184
    26. Pongo pygmaeus (Bornean orangutan) ppy-miR-184
    27. Pteropus alecto (black flying fox) pal-miR-184-3p
    28. Python bivittatus Pbv-Mir-184_3p (mature (guide))
    29. Rattus norvegicus rno-miR-184
    30. Sarcophilus harrisii Sha-Mir-184_3p (mature (guide))
    31. Sphenodon punctatus (tuatara) Spt-Mir-184_3p (mature (guide))
    32. Sus scrofa (pig) ssc-miR-184
    33. Taeniopygia guttata (zebra finch) tgu-miR-184
    34. Tupaia chinensis (Chinese tree shrew) tch-miR-184
    Publications New