Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-184-3p URS0000543D82_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (ENA, MirGeneDB, miRBase, RefSeq, LncBase, TarBase, PirBase). Described in 26 papers. Mus musculus (house mouse) mmu-miR-184-3p sequence is a product of Mir184, mmu-miR-184-3p, mmu-miR-184, miR-184-3p, miR-184, 184 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including Ctbp2, D7Ertd45e, ENSMUSG00000030970, Gtrgeo6, Ribeye.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGGACGGAGAACUGAUAAGGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 47 other species

    1. Alligator mississippiensis ami-miR-184-3p
    2. Anolis carolinensis aca-miR-184-3p
    3. Bos taurus (cattle) bta-miR-184
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-184
    5. Canis lupus familiaris (dog) cfa-miR-184
    6. Capra hircus chi-miR-184
    7. Cavia porcellus cpo-miR-184-3p
    8. Cervus elaphus (red deer) cel-miR-184
    9. Chrysemys picta bellii Cpi-Mir-184_3p (mature (guide))
    10. Chrysemys picta cpi-miR-184-3p
    11. Columba livia cli-miR-184-3p
    12. Cricetulus griseus (Chinese hamster) cgr-miR-184
    13. Dasypus novemcinctus (nine-banded armadillo) dno-miR-184-3p
    14. Echinops telfairi Ete-Mir-184_3p (mature (guide))
    15. Equus caballus eca-miR-184
    16. Gallus gallus (chicken) gga-miR-184-3p
    17. Homo sapiens (human) hsa-miR-184
    18. Macaca mulatta mml-miR-184
    19. Macaca nemestrina mne-miR-184
    20. Monodelphis domestica (gray short-tailed opossum) mdo-miR-184-3p
    21. Oryctolagus cuniculus ocu-miR-184-3p
    22. Otolemur garnettii oga-miR-184
    23. Pan troglodytes (chimpanzee) ptr-miR-184
    24. Pongo pygmaeus ppy-miR-184
    25. Pteropus alecto (black flying fox) pal-miR-184-3p
    26. Rattus norvegicus rno-miR-184
    27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-184_3p (mature (guide))
    28. Sus scrofa ssc-miR-184
    29. Taeniopygia guttata (zebra finch) tgu-miR-184
    30. Tupaia chinensis (Chinese tree shrew) tch-miR-184