Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-31-5p URS00005416E3_9606

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, miRBase, PSICQUIC, LncBase, RefSeq, TarBase, GeneCards, MalaCards). Described in 69 papers. Homo sapiens (human) hsa-miR-31-5p sequence is a product of MIR31, miR-31-5p, miR-31, hsa-miR-31, hsa-miR-31-5p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 16.3A5, 182-FIP, 2F1, 4F5REL, 71-7A, 82-FIP, 8B, 8D6, 8D6A.

Interactions 19

According to PSICQUIC, Homo sapiens (human) hsa-miR-31-5p interacts with:

Interaction id Participant Synonyms
URS00005416E3_9606-0 O95150 O95150
URS00005416E3_9606-10 O95150 O95150
URS00005416E3_9606-1 P05067 P05067
URS00005416E3_9606-11 P05067 P05067
URS00005416E3_9606-8 P11532 P11532
URS00005416E3_9606-12 P11532 P11532
URS00005416E3_9606-2 P16581 P16581
URS00005416E3_9606-13 P16581 P16581
URS00005416E3_9606-14 P21731 P21731
URS00005416E3_9606-3 P21731 P21731
URS00005416E3_9606-15 P29475 P29475
URS00005416E3_9606-4 P29475 P29475
URS00005416E3_9606-9 Q13009 Q13009
URS00005416E3_9606-16 Q13009 Q13009
URS00005416E3_9606-5 Q6V0I7 Q6V0I7
URS00005416E3_9606-6 Q6ZMJ4 Q6ZMJ4
URS00005416E3_9606-17 Q6ZMJ4 Q6ZMJ4
URS00005416E3_9606-7 Q9NWT6 Q9NWT6
URS00005416E3_9606-18 Q9NWT6 Q9NWT6

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGCAAGAUGCUGGCAUAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5 other species