Homo sapiens (human) small nucleolar RNA, C/D box 3A (SNORD3A)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) small nucleolar RNA, C/D box 3A (SNORD3A) URS000053962A_9606

217 nucleotides
10 databases (ENA, GeneCards, HGNC, IntAct, LNCipedia, MalaCards, PDBe, RefSeq, Rfam, snOPY)
Found in 0 other species
104 publications

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD3A: SNORD3A, a small nucleolar RNA (snoRNA), has been investigated in relation to prion disease progression and general stress [PMC3549992]. A study examined the levels of SNORD3A in RNA samples from the brains of wild-type (wt) and TgMHu2ME199K mice, which were administered copper for 75 days starting at 3 months of age [PMC3549992]. The study found a positive correlation between SNORD3A levels and UMPS levels, but a negative correlation with miR-185-5p levels [PMC7205983]. These findings suggest that SNORD3A expression may be specifically associated with prion disease progression rather than general stress [PMC7205983].

mRNA interactions 1 total

Targeting miRNAs 19 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AAGACUAUACUUUCAGGGAUCAUUUCUAUAGUGUGUUACUAGAGAAGUUUCUCUGAACGUGUAGAGCACCGAAAACCACGAGGAAGAGAGGUAGCGUUUUCUCCUGAGCGUGAAGCCGGCUUUCUGGCGUUGCUUGGCUGCAACUGCCGUCAGCCAUUGAUGAUCGUUCUUCUCUCCGUAUUGGGGAGUGAGAGGGAGAGAACGCGGUCUGAGUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure

Publications