Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-19a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-19a precursor URS0000539083_9606

  • 82 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 137 species

Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (ENA, GeneCards, MalaCards, Ensembl, miRBase, RefSeq, Ensembl/GENCODE, HGNC). Described in 60 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-19, RF00245). Homo sapiens (human) microRNA hsa-mir-19a precursor sequence is a product of hsa-mir-19a precursor, mir-19a precursor, ENSG00000284204.1, mir-19a precurso, MIR19A, mir-19a genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCAGUCCUCUGUUAGUUUUGCAUAGUUGCACUACAAGAAGAAUGUAGUUGUGCAAAUCUAUGCAAAACUGAUGGUGGCCUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 136 other species

    1. Ailuropoda melanoleuca microRNA 19a (ENSAMEG00000020647.2)
    2. Aotus nancymaae miRNA (ENSANAG00000000719.1)
    3. Bison bison bison miRNA (ENSBBBG00000022435.1)
    4. Bos indicus x Bos taurus (hybrid cattle) microRNA 19a (ENSBIXG00000021351.1, ENSBIXG00005001751.1)
    5. Bos mutus (wild yak) miRNA (ENSBMUG00000005845.1)
    6. Bos taurus (cattle) microRNA bta-mir-19a precursor
    7. Callithrix jacchus (white-tufted-ear marmoset) miRNA (ENSCJAG00000030780.2)
    8. Canis lupus dingo (dingo) microRNA 19a (ENSCAFG00020024023.1)
    9. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020582.1, ENSCAFG00030015951.1, ENSCAFG00040008550.1)
    10. Capra hircus microRNA chi-mir-19a precursor
    11. Catagonus wagneri microRNA 19a (ENSCWAG00000004664.1)
    12. Cavia aperea microRNA 19a (ENSCAPG00000002130.1)
    13. Cavia porcellus microRNA 19a (ENSCPOG00000020330.2)
    14. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000016254.1)
    15. Cervus elaphus hippelaphus ncRNA
    16. Cervus hanglu yarkandensis (Yarkand deer) miRNA (ENSCHYG00000024571.1)
    17. Chinchilla lanigera (Long-tailed chinchilla) microRNA 19a (ENSCLAG00000021033.1)
    18. Chlorocebus sabaeus miRNA (ENSCSAG00000027451.1)
    19. Colobus angolensis palliatus microRNA 19a (ENSCANG00000011736.1)
    20. Dipodomys ordii microRNA 19a (ENSDORG00000021052.2)
    21. Felis catus (domestic cat) miRNA (ENSFCAG00000016537.3)
    22. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000003018.1)
    23. Gorilla gorilla gorilla ggo-mir-19a (ENSGGOG00000033387.2)
    24. Gorilla gorilla (western gorilla) microRNA ggo-mir-19a precursor
    25. Heterocephalus glaber microRNA 19a (ENSHGLG00000022743.1, ENSHGLG00100024309.1)
    26. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 19a (ENSSTOG00000016707.1)
    27. Lemur catta microRNA lca-mir-19a precursor
    28. Loxodonta africana (African savanna elephant) microRNA 19a (ENSLAFG00000025449.1)
    29. Lynx canadensis microRNA 19a (ENSLCNG00005000304.1)
    30. Macaca fascicularis miRNA (ENSMFAG00000007696.2)
    31. Macaca mulatta microRNA mml-mir-19a precursor
    32. Macaca nemestrina mne-mir-19a (ENSMNEG00000001426.1)
    33. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000007125.1)
    34. Marmota marmota marmota (Alpine marmot) microRNA 19a (ENSMMMG00000021346.1)
    35. Microcebus murinus (gray mouse lemur) miRNA (ENSMICG00000035198.2)
    36. Monodelphis domestica (gray short-tailed opossum) mdo-mir-19a (ENSMODG00000022366.1)
    37. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000021561.1)
    38. Myotis lucifugus microRNA 19a (ENSMLUG00000017996.1)
    39. Neovison vison miRNA (ENSNVIG00000016024.1)
    40. Nomascus leucogenys miRNA (ENSNLEG00000020431.2)
    41. Notamacropus eugenii (tammar wallaby) microRNA 19a (ENSMEUG00000017693.1)
    42. Otolemur garnettii miRNA (ENSOGAG00000017325.1)
    43. Ovis aries (sheep) miRNA (ENSOARG00000022960.1, ENSOARG00020003640.1)
    44. Pan paniscus microRNA ppa-mir-19a precursor
    45. Panthera leo microRNA 19a (ENSPLOG00000001965.1)
    46. Panthera pardus microRNA 19a (ENSPPRG00000014169.1)
    47. Panthera tigris altaica (Tiger) miRNA (ENSPTIG00000002312.1)
    48. Pan troglodytes (chimpanzee) microRNA ptr-mir-19a precursor
    49. Papio anubis miRNA (ENSPANG00000018179.2)
    50. Phascolarctos cinereus microRNA 19a (ENSPCIG00000014761.2)
    51. Piliocolobus tephrosceles microRNA 19a (ENSPTEG00000009307.1)
    52. Pongo abelii microRNA 19a (ENSPPYG00000021438.1)
    53. Pongo pygmaeus microRNA ppy-mir-19a precursor
    54. Prolemur simus (greater bamboo lemur) microRNA 19a (ENSPSMG00000015425.1)
    55. Propithecus coquereli miRNA (ENSPCOG00000011082.1)
    56. Rhinolophus ferrumequinum microRNA 19a (ENSRFEG00010004629.1)
    57. Rhinopithecus bieti miRNA (ENSRBIG00000021994.1)
    58. Rhinopithecus roxellana microRNA 19a (ENSRROG00000016675.1)
    59. Saguinus labiatus microRNA sla-mir-19a precursor
    60. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000007427.1)
    61. Sarcophilus harrisii (Tasmanian devil) microRNA 19a (ENSSHAG00000020119.2)
    62. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005000706.1)
    63. Spermophilus dauricus miRNA (ENSSDAG00000003431.1)
    64. Suricata suricatta (meerkat) microRNA 19a (ENSSSUG00005007479.1)
    65. Sus scrofa microRNA ssc-mir-19a precursor
    66. Theropithecus gelada microRNA 19a (ENSTGEG00000009047.1)
    67. Urocitellus parryii (Arctic ground squirrel) microRNA 19a (ENSUPAG00010007915.1)
    68. Ursus americanus miRNA (ENSUAMG00000023256.1)
    69. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000025289.1)
    70. Ursus thibetanus thibetanus microRNA 19a (ENSUTTG00000000126.1)
    71. Vombatus ursinus microRNA 19a (ENSVURG00010023895.1)
    72. Vulpes vulpes miRNA (ENSVVUG00000006331.1)
    73. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015012898.1)
    2D structure New