Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays zma-miR169b-5p URS000052B358_4577

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Zea mays. Annotated by 3 databases (RefSeq, ENA, miRBase). Described in 5 papers. Zea mays zma-miR169b-5p sequence is a product of miR169b-5p, zma-miR169b, miR169, zma-miR169a-5p, MIR169a, zma-miR169b-5p, MIR169b, miR169b, miR169a-5p, miR169a, zma-miR169a genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGCCAAGGAUGACUUGCCGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 18 other species

    1. Aegilops tauschii ata-miR169g-5p
    2. Ananas comosus (pineapple) microRNA 169a
    3. Arabidopsis lyrata aly-miR169a-5p
    4. Arabidopsis thaliana ath-miR169a-5p
    5. Brachypodium distachyon (stiff brome) bdi-miR169a-5p
    6. Brassica napus bna-miR169a
    7. Camelina sativa cas-miR169a
    8. Glycine max gma-miR169b
    9. Linum usitatissimum lus-miR169l
    10. Manihot esculenta mes-miR169g
    11. Medicago truncatula (barrel medic) mtr-miR169a
    12. Nicotiana tabacum nta-miR169d
    13. Oryza sativa Japonica Group microRNA osa-miR169a
    14. Oryza sativa osa-miR169a
    15. Populus trichocarpa ptc-miR169c
    16. Solanum lycopersicum (tomato) sly-miR169c
    17. Sorghum bicolor (sorghum) sbi-miR169a
    18. Theobroma cacao (cacao) tcc-miR169c
    19. Vitis vinifera (wine grape) vvi-miR169f