Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR169c URS000052B358_4081

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCCAAGGAUGACUUGCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Aegilops tauschii ata-miR169g-5p
  2. Ananas comosus (pineapple) microRNA 169a
  3. Arabidopsis lyrata aly-miR169a-5p
  4. Arabidopsis thaliana ath-miR169a-5p
  5. Brachypodium distachyon bdi-miR169a-5p
  6. Brassica napus (rape) bna-miR169a
  7. Camelina sativa (false flax) cas-miR169a
  8. Glycine max gma-miR169b
  9. Linum usitatissimum (flax) lus-miR169l
  10. Manihot esculenta (cassava) mes-miR169g
  11. Medicago truncatula mtr-miR169a
  12. Nicotiana tabacum (common tobacco) nta-miR169b
  13. Oryza sativa Japonica Group microRNA osa-miR169a
  14. Oryza sativa (rice) osa-miR169a
  15. Populus trichocarpa ptc-miR169c
  16. Sorghum bicolor sbi-miR169a
  17. Theobroma cacao (cacao) tcc-miR169c
  18. Vitis vinifera (wine grape) vvi-miR169g
  19. Zea mays zma-miR169a-5p
Publications