v23

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Medicago truncatula (barrel medic) mtr-miR169a URS000052B358_3880

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGCCAAGGAUGACUUGCCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Aegilops tauschii ata-miR169g-5p
  2. Ananas comosus (pineapple) microRNA 169a
  3. Arabidopsis lyrata aly-miR169a-5p
  4. Arabidopsis thaliana ath-miR169a-5p
  5. Brachypodium distachyon bdi-miR169a-5p
  6. Brassica napus (rape) bna-miR169a
  7. Camelina sativa (false flax) cas-miR169a
  8. Glycine max gma-miR169b
  9. Linum usitatissimum (flax) lus-miR169l
  10. Manihot esculenta (cassava) mes-miR169g
  11. Nicotiana tabacum (common tobacco) nta-miR169b
  12. Oryza sativa Japonica Group microRNA osa-miR169a
  13. Oryza sativa (rice) osa-miR169a
  14. Populus trichocarpa ptc-miR169c
  15. Solanum lycopersicum (tomato) sly-miR169c
  16. Sorghum bicolor sbi-miR169a
  17. Theobroma cacao (cacao) tcc-miR169c
  18. Vitis vinifera (wine grape) vvi-miR169g
  19. Zea mays zma-miR169a-5p
 Publications