Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-183-5p URS0000528CBC_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (GeneCards, TarBase, RefSeq, LncBase, ENA, miRBase, MalaCards, MirGeneDB). Described in 70 papers. Homo sapiens (human) hsa-miR-183-5p sequence is a product of miR-183-5p, hsa-miR-183-5p, miR-183, hsa-miR-183, 183, MIR183 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 12CC4, 14-3-3GAMMA, 14-3-3γ, 15.5K, 1700010H15RiK, 170A, 2'-PDE, 2C4D, 30K, 3635.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUGGCACUGGUAGAAUUCACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 31 other species

    1. Alligator mississippiensis ami-miR-183-5p
    2. Bos taurus (cattle) Bta-Mir-96-P3-v1_5p (mature (guide))
    3. Branchiostoma floridae (Florida lancelet) bfl-miR-183
    4. Callithrix jacchus cja-miR-183
    5. Callorhinchus milii (elephant shark) eshark_mir-183_1
    6. Canis lupus familiaris (dog) cfa-miR-183
    7. Capra hircus (goat) chi-miR-183
    8. Cavia porcellus cpo-miR-183-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-183
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-96-P3-v1_5p (mature (guide))
    11. Ciona intestinalis Cin-Mir-96-P3_5p (mature (guide))
    12. Columba livia Cli-Mir-96-P3-v1_5p (mature (guide))
    13. Danio rerio Dre-Mir-96-P3-v1_5p (mature (guide))
    14. Dasypus novemcinctus dno-miR-183-5p
    15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-96-P3-v1_5p (mature (guide))
    16. Equus caballus (horse) eca-miR-183
    17. Gadus morhua gmo-miR-183-5p
    18. Gallus gallus (chicken) Gga-Mir-96-P3-v1_5p (mature (guide))
    19. Macaca mulatta Mml-Mir-96-P3-v1_5p (mature (guide))
    20. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-96-P3-v1_5p (mature (guide))
    21. Mus musculus mmu-miR-183-5p
    22. Ornithorhynchus anatinus oan-miR-183
    23. Oryctolagus cuniculus (rabbit) ocu-miR-183-5p
    24. Pongo pygmaeus ppy-miR-183
    25. Pteropus alecto pal-miR-183-5p
    26. Rattus norvegicus (Norway rat) rno-miR-183-5p
    27. Salmo salar ssa-miR-183-5p
    28. Sarcophilus harrisii Sha-Mir-96-P3-v1_5p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P3-v1_5p (mature (guide))
    30. Taeniopygia guttata (zebra finch) tgu-miR-183
    31. Tupaia chinensis (Chinese tree shrew) tch-miR-183-5p
    32. Xenopus tropicalis Xtr-Mir-96-P3-v1_5p (mature (guide))