Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-96-P3-v1_5p (mature (guide)) URS0000528CBC_13616

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Monodelphis domestica. Annotated by 1 database (MirGeneDB). Described in 1 paper. Found in the gray short-tailed opossum reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUGGCACUGGUAGAAUUCACU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Alligator mississippiensis ami-miR-183-5p
    2. Bos taurus (cattle) Bta-Mir-96-P3-v1_5p (mature (guide))
    3. Branchiostoma floridae bfl-miR-183
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-183
    5. Callorhinchus milii (elephant shark) eshark_mir-183_1
    6. Canis lupus familiaris (dog) cfa-miR-183
    7. Capra hircus chi-miR-183
    8. Cavia porcellus cpo-miR-183-5p
    9. Chiloscyllium plagiosum microRNA cpl-miR-183
    10. Chrysemys picta bellii Cpi-Mir-96-P3-v1_5p (mature (guide))
    11. Ciona intestinalis Cin-Mir-96-P3_5p (mature (guide))
    12. Columba livia Cli-Mir-96-P3-v1_5p (mature (guide))
    13. Danio rerio Dre-Mir-96-P3-v1_5p (mature (guide))
    14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-183-5p
    15. Echinops telfairi Ete-Mir-96-P3-v1_5p (mature (guide))
    16. Equus caballus eca-miR-183
    17. Gadus morhua (Atlantic cod) gmo-miR-183-5p
    18. Gallus gallus (chicken) Gga-Mir-96-P3-v1_5p (mature (guide))
    19. Homo sapiens (human) hsa-miR-183-5p
    20. Macaca mulatta Mml-Mir-96-P3-v1_5p (mature (guide))
    21. Mus musculus mmu-miR-183-5p
    22. Ornithorhynchus anatinus oan-miR-183
    23. Oryctolagus cuniculus ocu-miR-183-5p
    24. Pongo pygmaeus ppy-miR-183
    25. Pteropus alecto (black flying fox) pal-miR-183-5p
    26. Rattus norvegicus rno-miR-183-5p
    27. Salmo salar ssa-miR-183-5p
    28. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-96-P3-v1_5p (mature (guide))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-96-P3-v1_5p (mature (guide))
    30. Taeniopygia guttata (zebra finch) tgu-miR-183
    31. Tupaia chinensis (Chinese tree shrew) tch-miR-183-5p
    32. Xenopus tropicalis Xtr-Mir-96-P3-v1_5p (mature (guide))