v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-145 URS0000527F89_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-145: Bta-mir-145 is a microRNA that has been shown to be downregulated and can regulate lipid droplet formation and TAG accumulation [PMC8850724]. In a mated library, bta-mir-145 was one of the predominately expressed miRNAs [PMC8710055]. Previous studies have also identified bta-mir-145 in mammary tissue samples of Holstein cows [PMC8520644]. The downregulation of bta-mir-145 is associated with the production of IL-12 and TNF-α, which can induce an immune response [PMC7793973]. In udder parenchyma tissue infected with CoNS, bta-mir-145 was found to be differentially expressed, with downregulation observed [PMC7937231]. Assays used in the analysis included bta-mir-145 [PMC6691986]. Interestingly, in a heat-stressed group compared to a control group, the expression of bta-mir-145 tended to increase [PMC6309072].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCCAGUUUUCCCAGGAAUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Alligator mississippiensis Ami-Mir-145_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-145_5p (mature (guide))
  3. Callithrix jacchus cja-miR-145
  4. Callorhinchus milii Cmi-Mir-145_5p (mature (guide))
  5. Canis lupus familiaris (dog) cfa-miR-145
  6. Capra hircus (goat) chi-miR-145-5p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-145-5p
  8. Cervus elaphus (red deer) cel-miR-145
  9. Chrysemys picta bellii Cpi-Mir-145_5p (mature (guide))
  10. Chrysemys picta (Painted turtle) cpi-miR-145-5p
  11. Columba livia cli-miR-145-5p
  12. Danio rerio Dre-Mir-145_5p (mature (guide))
  13. Daubentonia madagascariensis dma-miR-145
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_5p (mature (guide))
  15. Equus caballus (horse) eca-miR-145
  16. Gadus morhua gmo-miR-145-5p
  17. Gallus gallus (chicken) Gga-Mir-145_5p (mature (guide))
  18. Gekko japonicus Gja-Mir-145_5p (mature (guide))
  19. Homo sapiens (human) hsa-miR-145-5p
  20. Ictalurus punctatus ipu-miR-145
  21. Latimeria chalumnae Lch-Mir-145_5p (mature (guide))
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-145_5p (mature (guide))
  23. Macaca mulatta Mml-Mir-145_5p (mature (guide))
  24. Microcaecilia unicolor Mun-Mir-145_5p (mature (guide))
  25. Microcebus murinus (gray mouse lemur) mmr-miR-145
  26. Monodelphis domestica mdo-miR-145-5p
  27. Monopterus albus Mal-Mir-145_5p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-145a-5p
  29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-145
  30. Oreochromis niloticus oni-miR-145
  31. Ornithorhynchus anatinus Oan-Mir-145_5p (mature (guide))
  32. Oryctolagus cuniculus ocu-miR-145-5p
  33. Otolemur garnettii (small-eared galago) oga-miR-145
  34. Pan paniscus (pygmy chimpanzee) ppa-miR-145
  35. Papio hamadryas (hamadryas baboon) pha-miR-145
  36. Petromyzon marinus pma-miR-145-5p
  37. Pteropus alecto pal-miR-145-5p
  38. Python bivittatus (Burmese python) pbv-miR-145-5p
  39. Rattus norvegicus (Norway rat) rno-miR-145-5p
  40. Salmo salar (Atlantic salmon) ssa-miR-145-5p
  41. Sarcophilus harrisii Sha-Mir-145_5p (mature (guide))
  42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_5p (mature (guide))
  43. Sphenodon punctatus (tuatara) Spt-Mir-145_5p (mature (guide))
  44. Taeniopygia guttata Tgu-Mir-145_5p (mature (guide))
  45. Tursiops truncatus (common bottlenose dolphin) miR-145a-5p
  46. Xenopus laevis (African clawed frog) Xla-Mir-145-P2_5p (mature (guide))
  47. Xenopus tropicalis Xtr-Mir-145_5p (mature (guide))
 Publications