Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-145-5p URS0000527F89_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-145: Rno-mir-145 is a type of miRNA precursor that has been studied in various contexts. It has been shown that rno-mir-145 is one of several miRNAs that can be mimicked using a precursor called Pre-miRâ„¢ miRNA precursor (miR-145 mimic) [PMC5832640]. In the context of swimming exercise-induced cardiac hypertrophy, rno-mir-145 has been found to be one of the miRNAs that target components of the PI3K/AKT/mTOR signaling pathway [PMC5908320]. The levels of rno-mir-145 have been observed to fluctuate over time, with a reduction at 2 and 4 hours, a slight increase at 12 and 24 hours, and then a decrease again at later time points [PMC5979605]. In addition, rno-mir-145 has shown a positive correlation with the PACAP-preferring receptor Adcyap1r1 mRNAs [PMC5979605]. To study the effects of rno-mir-145 inhibition, an inhibitor specific to this miRNA called MiR-145 inhibitor (rno-mir-145 inhibitor) was used [PMC3445575]. The expression levels of rno-mir-145 were quantified using TaqMan mature miR assays [PMC5838212]. Based on the gene sequence in the miBase database, an oligonucleotide chain containing the sequence for rno-mir-145 was designed for further experiments [PMC4961289].

mRNA interactions 6 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCAGUUUUCCCAGGAAUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Alligator mississippiensis Ami-Mir-145_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-145_5p (mature (guide))
  3. Bos taurus bta-miR-145
  4. Callithrix jacchus cja-miR-145
  5. Callorhinchus milii Cmi-Mir-145_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-145
  7. Capra hircus (goat) chi-miR-145-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-145-5p
  9. Cervus elaphus (red deer) cel-miR-145
  10. Chrysemys picta bellii Cpi-Mir-145_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-145-5p
  12. Columba livia cli-miR-145-5p
  13. Danio rerio Dre-Mir-145_5p (mature (guide))
  14. Daubentonia madagascariensis dma-miR-145
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-145
  17. Gadus morhua gmo-miR-145-5p
  18. Gallus gallus (chicken) Gga-Mir-145_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-145_5p (mature (guide))
  20. Homo sapiens (human) hsa-miR-145-5p
  21. Ictalurus punctatus ipu-miR-145
  22. Latimeria chalumnae Lch-Mir-145_5p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-145_5p (mature (guide))
  24. Macaca mulatta Mml-Mir-145_5p (mature (guide))
  25. Microcaecilia unicolor Mun-Mir-145_5p (mature (guide))
  26. Microcebus murinus (gray mouse lemur) mmr-miR-145
  27. Monodelphis domestica mdo-miR-145-5p
  28. Monopterus albus Mal-Mir-145_5p (mature (guide))
  29. Mus musculus (house mouse) mmu-miR-145a-5p
  30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-145
  31. Oreochromis niloticus oni-miR-145
  32. Ornithorhynchus anatinus Oan-Mir-145_5p (mature (guide))
  33. Oryctolagus cuniculus ocu-miR-145-5p
  34. Otolemur garnettii (small-eared galago) oga-miR-145
  35. Pan paniscus (pygmy chimpanzee) ppa-miR-145
  36. Papio hamadryas (hamadryas baboon) pha-miR-145
  37. Petromyzon marinus pma-miR-145-5p
  38. Pteropus alecto pal-miR-145-5p
  39. Python bivittatus (Burmese python) pbv-miR-145-5p
  40. Salmo salar (Atlantic salmon) ssa-miR-145-5p
  41. Sarcophilus harrisii Sha-Mir-145_5p (mature (guide))
  42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_5p (mature (guide))
  43. Sphenodon punctatus (tuatara) Spt-Mir-145_5p (mature (guide))
  44. Taeniopygia guttata Tgu-Mir-145_5p (mature (guide))
  45. Tursiops truncatus (common bottlenose dolphin) miR-145a-5p
  46. Xenopus laevis (African clawed frog) Xla-Mir-145-P2_5p (mature (guide))
  47. Xenopus tropicalis Xtr-Mir-145_5p (mature (guide))
Publications