Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-145-5p URS0000527F89_9606

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (GeneCards, IntAct, TarBase, RefSeq, LncBase, ENA, miRBase, MalaCards, MirGeneDB). Described in 88 papers. Homo sapiens (human) hsa-miR-145-5p sequence is a product of MIR145, miR-145-5p, hsa-miR-145-5p, miR-145, hsa-miR-145 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16.3A5, 182-FIP, 3G2, 5-HT2A, 53BP1, 82-FIP, A20, A3b, AADACL1, AAK1.

Interactions 5

According to IntAct, Homo sapiens (human) hsa-miR-145-5p interacts with:

IntAct ID Participant Synonyms
EBI-26436366 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-26436519 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-26436559 intact:EBI-20558404 EBI-20558404 ENST00000650285 mrna_igf1r
EBI-25468585 intact:EBI-25468563 EBI-25468563 ENST00000377687 mrna_klf5
EBI-25468662 intact:EBI-25468596 EBI-25468596 ENST00000428726 mrna_cd44

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCCAGUUUUCCCAGGAAUCCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Alligator mississippiensis Ami-Mir-145_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-145_5p (mature (guide))
    3. Bos taurus (cattle) bta-miR-145
    4. Callithrix jacchus cja-miR-145
    5. Canis lupus familiaris (dog) cfa-miR-145
    6. Capra hircus (goat) chi-miR-145-5p
    7. Cavia porcellus cpo-miR-145-5p
    8. Cervus elaphus (red deer) cel-miR-145
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-145_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-145-5p
    11. Columba livia cli-miR-145-5p
    12. Danio rerio Dre-Mir-145_5p (mature (guide))
    13. Daubentonia madagascariensis dma-miR-145
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_5p (mature (guide))
    15. Equus caballus (horse) eca-miR-145
    16. Gadus morhua gmo-miR-145-5p
    17. Gallus gallus (chicken) Gga-Mir-145_5p (mature (guide))
    18. Ictalurus punctatus ipu-miR-145
    19. Macaca mulatta Mml-Mir-145_5p (mature (guide))
    20. Microcebus murinus (gray mouse lemur) mmr-miR-145
    21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-145-5p
    22. Mus musculus mmu-miR-145a-5p
    23. Nomascus leucogenys nle-miR-145
    24. Oreochromis niloticus (Nile tilapia) oni-miR-145
    25. Ornithorhynchus anatinus Oan-Mir-145_5p (mature (guide))
    26. Oryctolagus cuniculus (rabbit) ocu-miR-145-5p
    27. Otolemur garnettii (small-eared galago) oga-miR-145
    28. Pan paniscus ppa-miR-145
    29. Papio hamadryas (hamadryas baboon) pha-miR-145
    30. Petromyzon marinus (sea lamprey) pma-miR-145-5p
    31. Pteropus alecto pal-miR-145-5p
    32. Python bivittatus (Burmese python) pbv-miR-145-5p
    33. Rattus norvegicus (Norway rat) rno-miR-145-5p
    34. Salmo salar ssa-miR-145-5p
    35. Sarcophilus harrisii Sha-Mir-145_5p (mature (guide))
    36. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_5p (mature (guide))
    37. Tursiops truncatus (common bottlenose dolphin) miR-145a-5p
    38. Xenopus laevis (African clawed frog) xla-miR-145
    39. Xenopus tropicalis Xtr-Mir-145_5p (mature (guide))