Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-145a-5p URS0000527F89_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 6 databases (PirBase, TarBase, RefSeq, ENA, miRBase, MirGeneDB). Described in 47 papers. Mus musculus (house mouse) mmu-miR-145a-5p sequence is a product of mmu-miR-145a-5p, miR-145a-5p, Mir145a, miR-145, mmu-miR-145a, miR-145a genes. Interacts with protein-coding genes, including 0610006A03Rik, 0610007L05Rik, 0610008P16Rik, 0610010I13Rik, 0610011C19Rik, 0610033L03Rik, 0710008J23Rik, 0910001N05Rik, 1-AGP, 1010001P14Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUCCAGUUUUCCCAGGAAUCCCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 38 other species

    1. Alligator mississippiensis Ami-Mir-145_5p (mature (guide))
    2. Anolis carolinensis Aca-Mir-145_5p (mature (guide))
    3. Bos taurus (cattle) bta-miR-145
    4. Callithrix jacchus cja-miR-145
    5. Canis lupus familiaris (dog) cfa-miR-145
    6. Capra hircus (goat) chi-miR-145-5p
    7. Cavia porcellus cpo-miR-145-5p
    8. Cervus elaphus (red deer) cel-miR-145
    9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-145_5p (mature (guide))
    10. Chrysemys picta (Painted turtle) cpi-miR-145-5p
    11. Columba livia cli-miR-145-5p
    12. Danio rerio Dre-Mir-145_5p (mature (guide))
    13. Daubentonia madagascariensis dma-miR-145
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_5p (mature (guide))
    15. Equus caballus (horse) eca-miR-145
    16. Gadus morhua gmo-miR-145-5p
    17. Gallus gallus (chicken) Gga-Mir-145_5p (mature (guide))
    18. Homo sapiens (human) hsa-miR-145-5p
    19. Ictalurus punctatus ipu-miR-145
    20. Macaca mulatta Mml-Mir-145_5p (mature (guide))
    21. Microcebus murinus (gray mouse lemur) mmr-miR-145
    22. Monodelphis domestica (gray short-tailed opossum) mdo-miR-145-5p
    23. Nomascus leucogenys nle-miR-145
    24. Oreochromis niloticus (Nile tilapia) oni-miR-145
    25. Ornithorhynchus anatinus Oan-Mir-145_5p (mature (guide))
    26. Oryctolagus cuniculus (rabbit) ocu-miR-145-5p
    27. Otolemur garnettii (small-eared galago) oga-miR-145
    28. Pan paniscus ppa-miR-145
    29. Papio hamadryas (hamadryas baboon) pha-miR-145
    30. Petromyzon marinus (sea lamprey) pma-miR-145-5p
    31. Pteropus alecto pal-miR-145-5p
    32. Python bivittatus (Burmese python) pbv-miR-145-5p
    33. Rattus norvegicus (Norway rat) rno-miR-145-5p
    34. Salmo salar ssa-miR-145-5p
    35. Sarcophilus harrisii Sha-Mir-145_5p (mature (guide))
    36. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_5p (mature (guide))
    37. Tursiops truncatus (common bottlenose dolphin) miR-145a-5p
    38. Xenopus laevis (African clawed frog) xla-miR-145
    39. Xenopus tropicalis Xtr-Mir-145_5p (mature (guide))