Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-145a-5p URS0000527F89_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

Mmu-Mir-145: Mmu-mir-145 is a microRNA that has been studied in various contexts. It has been selected based on its high or low signal intensity in microarray analysis, as well as its potential role in lung pathology [PMC3030602]. Differential analysis of mmu-mir-145 has shown down-regulation during ovarian growth, indicating its involvement in cell proliferation [PMC4499447]. Similarity in sequence and function has been observed between mmu-mir-145 and hsa-miR-145 [PMC3926854]. Mmu-mir-145 has also been chosen for validation based on its target genes, which are relevant to inflammation and cancer [PMC4062425]. It is enriched in murine cardiac progenitor cells and during cardiogenesis [PMC7936154]. In genetically obese mice, mmu-mir-145 exhibits increased hepatic expression [PMC7936154]. Mmu-mir-145 is one of the top differentially expressed miRNAs in abdominal aortic aneurysm (AAA), with significant downregulation observed [PMC7377859]. It maps to chromosome 7 and exhibits a high LOD score, with each eQTL explaining 21% of the observed variation on average [PMC3130556]. In a study analyzing the expression of mmu-mir-145 and mmu-miR-483* in mice under different diets, a negative correlation between the two miRNAs was observed in the control group but was dampened with CDAA treatment [PMC5058762].

mRNA interactions 22 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUCCAGUUUUCCCAGGAAUCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 47 other species

  1. Alligator mississippiensis Ami-Mir-145_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-145_5p (mature (guide))
  3. Bos taurus bta-miR-145
  4. Callithrix jacchus cja-miR-145
  5. Callorhinchus milii Cmi-Mir-145_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-145
  7. Capra hircus (goat) chi-miR-145-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-145-5p
  9. Cervus elaphus (red deer) cel-miR-145
  10. Chrysemys picta bellii Cpi-Mir-145_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-145-5p
  12. Columba livia cli-miR-145-5p
  13. Danio rerio Dre-Mir-145_5p (mature (guide))
  14. Daubentonia madagascariensis dma-miR-145
  15. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-145_5p (mature (guide))
  16. Equus caballus (horse) eca-miR-145
  17. Gadus morhua gmo-miR-145-5p
  18. Gallus gallus (chicken) Gga-Mir-145_5p (mature (guide))
  19. Gekko japonicus Gja-Mir-145_5p (mature (guide))
  20. Homo sapiens (human) hsa-miR-145-5p
  21. Ictalurus punctatus ipu-miR-145
  22. Latimeria chalumnae Lch-Mir-145_5p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-145_5p (mature (guide))
  24. Macaca mulatta Mml-Mir-145_5p (mature (guide))
  25. Microcaecilia unicolor Mun-Mir-145_5p (mature (guide))
  26. Microcebus murinus (gray mouse lemur) mmr-miR-145
  27. Monodelphis domestica mdo-miR-145-5p
  28. Monopterus albus Mal-Mir-145_5p (mature (guide))
  29. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-145
  30. Oreochromis niloticus oni-miR-145
  31. Ornithorhynchus anatinus Oan-Mir-145_5p (mature (guide))
  32. Oryctolagus cuniculus ocu-miR-145-5p
  33. Otolemur garnettii (small-eared galago) oga-miR-145
  34. Pan paniscus (pygmy chimpanzee) ppa-miR-145
  35. Papio hamadryas (hamadryas baboon) pha-miR-145
  36. Petromyzon marinus pma-miR-145-5p
  37. Pteropus alecto pal-miR-145-5p
  38. Python bivittatus (Burmese python) pbv-miR-145-5p
  39. Rattus norvegicus (Norway rat) rno-miR-145-5p
  40. Salmo salar (Atlantic salmon) ssa-miR-145-5p
  41. Sarcophilus harrisii Sha-Mir-145_5p (mature (guide))
  42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-145_5p (mature (guide))
  43. Sphenodon punctatus (tuatara) Spt-Mir-145_5p (mature (guide))
  44. Taeniopygia guttata Tgu-Mir-145_5p (mature (guide))
  45. Tursiops truncatus (common bottlenose dolphin) miR-145a-5p
  46. Xenopus laevis (African clawed frog) Xla-Mir-145-P2_5p (mature (guide))
  47. Xenopus tropicalis Xtr-Mir-145_5p (mature (guide))
Publications