Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30c-2-3p URS0000527228_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (MirGeneDB, LncBase, GeneCards, PSICQUIC, TarBase, MalaCards, RefSeq, miRBase, ENA). Described in 54 papers. Homo sapiens (human) hsa-miR-30c-2-3p sequence is a product of hsa-miR-30c-2-3p, miR-30c-2, miR-30c-2-3p, MIR30C2, hsa-miR-30c-2 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 156DAG, 3D3, 4F2, 4F2HC, 4T2HC, A2D, A2lp, A3a, AAAT, AAK1.

Interactions 4

According to PSICQUIC, Homo sapiens (human) hsa-miR-30c-2-3p interacts with:

Interaction id Participant Synonyms
URS0000527228_9606-0 P24864 P24864
URS0000527228_9606-2 P24864 P24864
URS0000527228_9606-1 Q15628 Q15628
URS0000527228_9606-3 Q15628 Q15628

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGGGAGAAGGCUGUUUACUCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Alligator mississippiensis Ami-Mir-30-P2a_3p* (star (passenger))
    2. Anolis carolinensis aca-miR-30c-3p
    3. Bos taurus (cattle) Bta-Mir-30-P2a_3p* (star (passenger))
    4. Canis lupus familiaris (dog) Cfa-Mir-30-P2a_3p* (star (passenger))
    5. Cavia porcellus cpo-miR-30c-2-3p
    6. Cervus elaphus (red deer) Cel-miR-30c*
    7. Chrysemys picta bellii Cpi-Mir-30-P2a_3p* (star (passenger))
    8. Chrysemys picta cpi-miR-30c-2-3p
    9. Columba livia cli-miR-30c-2-3p
    10. Gallus gallus (chicken) Gga-Mir-30-P2a_3p* (star (passenger))
    11. Macaca mulatta Mml-Mir-30-P2a_3p* (star (passenger))
    12. Mus musculus mmu-miR-30c-2-3p
    13. Ophiophagus hannah oha-miR-30c-1-3p
    14. Ornithorhynchus anatinus oan-miR-30c-2-3p
    15. Oryctolagus cuniculus ocu-miR-30c-2-3p
    16. Python bivittatus pbv-miR-30c-3p
    17. Rattus norvegicus rno-miR-30c-2-3p
    18. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2a_3p* (star (passenger))
    19. Sus scrofa ssc-miR-30c-3p
    20. Taeniopygia guttata (zebra finch) tgu-miR-30c-3p