Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-148b URS0000521626_9913

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Bos taurus. Annotated by 4 databases (ENA, miRBase, RefSeq, MirGeneDB). Described in 7 papers. Bos taurus (cattle) bta-miR-148b sequence is a product of 148, miR-148b, miR-148, 148b, bta-miR-148b, MIR148B genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCAGUGCAUCACAGAACUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Alligator mississippiensis Ami-Mir-148-P3_3p (mature (guide))
    2. Anolis carolinensis aca-miR-148b-3p
    3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-148b
    4. Callorhinchus milii (elephant shark) eshark_mir-148_1
    5. Canis lupus familiaris (dog) cfa-miR-148b
    6. Capra hircus chi-miR-148b-3p
    7. Cavia porcellus cpo-miR-148b-3p
    8. Cervus elaphus (red deer) cel-miR-148b
    9. Chrysemys picta bellii Cpi-Mir-148-P3_3p (mature (guide))
    10. Chrysemys picta cpi-miR-148b-3p
    11. Cricetulus griseus (Chinese hamster) cgr-miR-148b-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-148b-3p
    13. Echinops telfairi Ete-Mir-148-P3_3p (mature (guide))
    14. Equus caballus eca-miR-148b-3p
    15. Homo sapiens (human) hsa-miR-148b-3p
    16. Macaca mulatta mml-miR-148b-3p
    17. Mus musculus mmu-miR-148b-3p
    18. Ophiophagus hannah oha-miR-148b
    19. Oryctolagus cuniculus ocu-miR-148b-3p
    20. Pan troglodytes (chimpanzee) ptr-miR-148b
    21. Pongo pygmaeus ppy-miR-148b
    22. Pteropus alecto (black flying fox) pal-miR-148b-3p
    23. Python bivittatus pbv-miR-148b-3p
    24. Rattus norvegicus rno-miR-148b-3p
    25. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-148-P3_3p (mature (guide))
    26. Sus scrofa ssc-miR-148b-3p
    27. Tupaia chinensis (Chinese tree shrew) tch-miR-148b-3p
    28. Xenopus laevis xla-miR-148b
    29. Xenopus tropicalis xtr-miR-148b