Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-148b-3p URS0000521626_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (ENA, LncBase, TarBase, MirGeneDB, RefSeq, miRBase, PirBase). Described in 20 papers. Mus musculus (house mouse) mmu-miR-148b-3p sequence is a product of mmu-miR-148b, mmu-miR-148b-3p, Mir148b, miR-148b-3p, miR-148, miR-148b genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including (P)RR, 0610007H07Rik, 0610007M19Rik, 0610011L04Rik, 0610012A05Rik, 0610038K04Rik, 0610043A03Rik, 1010001C15Rik, 1110002J03Rik, 1110003F05Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCAGUGCAUCACAGAACUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Alligator mississippiensis Ami-Mir-148-P3_3p (mature (guide))
    2. Anolis carolinensis aca-miR-148b-3p
    3. Bos taurus (cattle) bta-miR-148b
    4. Callithrix jacchus cja-miR-148b
    5. Callorhinchus milii (elephant shark) eshark_mir-148_1
    6. Canis lupus familiaris (dog) cfa-miR-148b
    7. Capra hircus (goat) chi-miR-148b-3p
    8. Cavia porcellus cpo-miR-148b-3p
    9. Cervus elaphus (red deer) cel-miR-148b
    10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P3_3p (mature (guide))
    11. Chrysemys picta (Painted turtle) cpi-miR-148b-3p
    12. Cricetulus griseus (Chinese hamster) cgr-miR-148b-3p
    13. Dasypus novemcinctus dno-miR-148b-3p
    14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-148-P3_3p (mature (guide))
    15. Equus caballus (horse) eca-miR-148b-3p
    16. Homo sapiens (human) hsa-miR-148b-3p
    17. Macaca mulatta mml-miR-148b-3p
    18. Ophiophagus hannah oha-miR-148b
    19. Oryctolagus cuniculus (rabbit) ocu-miR-148b-3p
    20. Pan troglodytes (chimpanzee) ptr-miR-148b
    21. Pongo pygmaeus ppy-miR-148b
    22. Pteropus alecto pal-miR-148b-3p
    23. Python bivittatus (Burmese python) pbv-miR-148b-3p
    24. Rattus norvegicus (Norway rat) rno-miR-148b-3p
    25. Sarcophilus harrisii Sha-Mir-148-P3_3p (mature (guide))
    26. Sus scrofa (pig) ssc-miR-148b-3p
    27. Tupaia chinensis (Chinese tree shrew) tch-miR-148b-3p
    28. Xenopus laevis (African clawed frog) xla-miR-148b
    29. Xenopus tropicalis xtr-miR-148b