Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-190a URS0000520927_9615

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAUAUGUUUGAUAUAUUAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 21 other species

  1. Bos taurus (cattle) bta-miR-190a
  2. Chrysemys picta (Painted turtle) cpi-miR-190a-5p
  3. Danio rerio dre-miR-190a
  4. Equus caballus (horse) eca-miR-190a
  5. Gallus gallus gga-miR-190a-5p
  6. Gorilla gorilla gorilla ggo-miR-190a (MIR190A)
  7. Gorilla gorilla (western gorilla) ggo-miR-190a
  8. Homo sapiens (human) hsa-miR-190a-5p
  9. Macaca mulatta mml-miR-190a-5p
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-190a-5p
  11. Mus musculus (house mouse) mmu-miR-190a-5p
  12. Ornithorhynchus anatinus (platypus) oan-miR-190a-5p
  13. Pan paniscus ppa-miR-190
  14. Pan troglodytes ptr-miR-190a
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-190a
  16. Rattus norvegicus (Norway rat) rno-miR-190a-5p
  17. Sarcophilus harrisii sha-miR-190
  18. Taeniopygia guttata (zebra finch) tgu-miR-190-5p
  19. Takifugu rubripes fru-miR-190
  20. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-190
  21. Tor tambroides (Thai mahseer) miR-190a
Publications