Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Isoleucine tRNA (tRNA-Ile), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Isoleucine tRNA (tRNA-Ile), predicted by tRNAscan-SE analysis URS000051C6FE_559292

Automated summary: This ncRNA sequence is 74 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (Rfam, SGD, ENA). Described in 40 papers. Has a conserved secondary structure or a structured region. Saccharomyces cerevisiae S288C Isoleucine tRNA (tRNA-Ile), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Ile-AAT-1-12, tRNA-Ile-AAT-1-10, tRNA-Ile-AAT-1-8, tRNA-Ile-AAT-1-1, tRNA-Ile-AAT-1-5, tRNA-Ile-AAT-1-7, tRNA-Ile-AAT-1-6, tRNA-Ile-AAT-1-9, tRNA-Ile-AAT-1-4, tRNA-Ile-AAT-1-13, tRNA-Ile-AAT-1-11, tRNA-Ile-AAT-1-2, tRNA-Ile-AAT-1-3 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUCUCUUGGCCCAGUUGGUUAAGGCACCGUGCUAAUAACGCGGGGAUCAGCGGUUCGAUCCCGCUAGAGACCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 131 other species

    1. [Candida] glabrata tRNA Ile (AAT) cove score=71.40
    2. Kazachstania africana CBS 2517 tRNA-Ile
    3. Lachancea dasiensis tRNA
    4. Lachancea fermentati tRNA-Ile (AAT) cove score=71.40
    5. Lachancea lanzarotensis tRNA-Ile (AAT) cove score=71.40
    6. Lachancea meyersii CBS 8951 tRNA-Ile (AAT) cove score=71.40
    7. Lachancea mirantina tRNA-Ile (AAT) cove score=71.40
    8. Lachancea nothofagi CBS 11611 tRNA
    9. Lachancea quebecensis transfer RNA
    10. Lachancea sp. CBS 6924 tRNA-Ile (AAT) cove score=71.40
    11. Lachancea thermotolerans CBS 6340 tRNA-Ile (AAT) cove score=71.40
    12. Lachancea thermotolerans partial transfer RNA
    13. Naumovozyma dairenensis CBS 421 tRNA
    14. Saccharomyces arboricola H-6 tRNA
    15. Saccharomyces cerevisiae AWRI796 tRNA
    16. Saccharomyces cerevisiae tRNA-Ile gene, anticodon aat, len: 74
    17. Saccharomyces cerevisiae EC1118 tRNA-Ile
    18. Saccharomyces cerevisiae FostersB tRNA
    19. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Ile
    20. Saccharomyces cerevisiae Lalvin QA23 tRNA
    21. Saccharomyces cerevisiae P283 tRNA-Ile
    22. Saccharomyces cerevisiae P301 tRNA-Ile
    23. Saccharomyces cerevisiae PE-2 tRNA-Ile
    24. Saccharomyces cerevisiae R008 tRNA-Ile
    25. Saccharomyces cerevisiae R103 tRNA-Ile
    26. Saccharomyces cerevisiae RM11-1a tRNA-Ile
    27. Saccharomyces cerevisiae Vin13 tRNA
    28. Saccharomyces cerevisiae VL3 tRNA
    29. Saccharomyces cerevisiae YJM1078 tRNA-Ile
    30. Saccharomyces cerevisiae YJM1083 tRNA-Ile
    31. Saccharomyces cerevisiae YJM1129 tRNA-Ile
    32. Saccharomyces cerevisiae YJM1133 tRNA-Ile
    33. Saccharomyces cerevisiae YJM1190 tRNA-Ile
    34. Saccharomyces cerevisiae YJM1199 tRNA-Ile
    35. Saccharomyces cerevisiae YJM1202 tRNA-Ile
    36. Saccharomyces cerevisiae YJM1208 tRNA-Ile
    37. Saccharomyces cerevisiae YJM1242 tRNA-Ile
    38. Saccharomyces cerevisiae YJM1244 tRNA-Ile
    39. Saccharomyces cerevisiae YJM1248 tRNA-Ile
    40. Saccharomyces cerevisiae YJM1250 tRNA-Ile
    41. Saccharomyces cerevisiae YJM1252 tRNA-Ile
    42. Saccharomyces cerevisiae YJM1273 tRNA-Ile
    43. Saccharomyces cerevisiae YJM1304 tRNA-Ile
    44. Saccharomyces cerevisiae YJM1307 tRNA-Ile
    45. Saccharomyces cerevisiae YJM1311 tRNA-Ile
    46. Saccharomyces cerevisiae YJM1326 tRNA-Ile
    47. Saccharomyces cerevisiae YJM1332 tRNA-Ile
    48. Saccharomyces cerevisiae YJM1336 tRNA-Ile
    49. Saccharomyces cerevisiae YJM1338 tRNA-Ile
    50. Saccharomyces cerevisiae YJM1341 tRNA-Ile
    51. Saccharomyces cerevisiae YJM1342 tRNA-Ile
    52. Saccharomyces cerevisiae YJM1355 tRNA-Ile
    53. Saccharomyces cerevisiae YJM1356 tRNA-Ile
    54. Saccharomyces cerevisiae YJM1381 tRNA-Ile
    55. Saccharomyces cerevisiae YJM1383 tRNA-Ile
    56. Saccharomyces cerevisiae YJM1385 tRNA-Ile
    57. Saccharomyces cerevisiae YJM1386 tRNA-Ile
    58. Saccharomyces cerevisiae YJM1387 tRNA-Ile
    59. Saccharomyces cerevisiae YJM1388 tRNA-Ile
    60. Saccharomyces cerevisiae YJM1389 tRNA-Ile
    61. Saccharomyces cerevisiae YJM1399 tRNA-Ile
    62. Saccharomyces cerevisiae YJM1400 tRNA-Ile
    63. Saccharomyces cerevisiae YJM1401 tRNA-Ile
    64. Saccharomyces cerevisiae YJM1402 tRNA-Ile
    65. Saccharomyces cerevisiae YJM1415 tRNA-Ile
    66. Saccharomyces cerevisiae YJM1417 tRNA-Ile
    67. Saccharomyces cerevisiae YJM1418 tRNA-Ile
    68. Saccharomyces cerevisiae YJM1419 tRNA-Ile
    69. Saccharomyces cerevisiae YJM1433 tRNA-Ile
    70. Saccharomyces cerevisiae YJM1434 tRNA-Ile
    71. Saccharomyces cerevisiae YJM1439 tRNA-Ile
    72. Saccharomyces cerevisiae YJM1443 tRNA-Ile
    73. Saccharomyces cerevisiae YJM1444 tRNA-Ile
    74. Saccharomyces cerevisiae YJM1447 tRNA-Ile
    75. Saccharomyces cerevisiae YJM1450 tRNA-Ile
    76. Saccharomyces cerevisiae YJM1460 tRNA-Ile
    77. Saccharomyces cerevisiae YJM1463 tRNA-Ile
    78. Saccharomyces cerevisiae YJM1477 tRNA-Ile
    79. Saccharomyces cerevisiae YJM1478 tRNA-Ile
    80. Saccharomyces cerevisiae YJM1479 tRNA-Ile
    81. Saccharomyces cerevisiae YJM1526 tRNA-Ile
    82. Saccharomyces cerevisiae YJM1527 tRNA-Ile
    83. Saccharomyces cerevisiae YJM1549 tRNA-Ile
    84. Saccharomyces cerevisiae YJM1573 tRNA-Ile
    85. Saccharomyces cerevisiae YJM1574 tRNA-Ile
    86. Saccharomyces cerevisiae YJM1592 tRNA-Ile
    87. Saccharomyces cerevisiae YJM1615 tRNA-Ile
    88. Saccharomyces cerevisiae YJM189 tRNA-Ile
    89. Saccharomyces cerevisiae YJM193 tRNA-Ile
    90. Saccharomyces cerevisiae YJM195 tRNA-Ile
    91. Saccharomyces cerevisiae YJM244 tRNA-Ile
    92. Saccharomyces cerevisiae YJM248 tRNA-Ile
    93. Saccharomyces cerevisiae YJM270 tRNA-Ile
    94. Saccharomyces cerevisiae YJM271 tRNA-Ile
    95. Saccharomyces cerevisiae YJM320 tRNA-Ile
    96. Saccharomyces cerevisiae YJM326 tRNA-Ile
    97. Saccharomyces cerevisiae YJM428 tRNA-Ile
    98. Saccharomyces cerevisiae YJM450 tRNA-Ile
    99. Saccharomyces cerevisiae YJM451 tRNA-Ile
    100. Saccharomyces cerevisiae YJM453 tRNA-Ile
    101. Saccharomyces cerevisiae YJM456 tRNA-Ile
    102. Saccharomyces cerevisiae YJM470 tRNA-Ile
    103. Saccharomyces cerevisiae YJM541 tRNA-Ile
    104. Saccharomyces cerevisiae YJM554 tRNA-Ile
    105. Saccharomyces cerevisiae YJM555 tRNA-Ile
    106. Saccharomyces cerevisiae YJM627 tRNA-Ile
    107. Saccharomyces cerevisiae YJM681 tRNA-Ile
    108. Saccharomyces cerevisiae YJM682 tRNA-Ile
    109. Saccharomyces cerevisiae YJM683 tRNA-Ile
    110. Saccharomyces cerevisiae YJM689 tRNA-Ile
    111. Saccharomyces cerevisiae YJM693 tRNA-Ile
    112. Saccharomyces cerevisiae YJM969 tRNA-Ile
    113. Saccharomyces cerevisiae YJM972 tRNA-Ile
    114. Saccharomyces cerevisiae YJM975 tRNA-Ile
    115. Saccharomyces cerevisiae YJM978 tRNA-Ile
    116. Saccharomyces cerevisiae YJM981 tRNA-Ile
    117. Saccharomyces cerevisiae YJM984 tRNA-Ile
    118. Saccharomyces cerevisiae YJM987 tRNA-Ile
    119. Saccharomyces cerevisiae YJM990 tRNA-Ile
    120. Saccharomyces cerevisiae YJM993 tRNA-Ile
    121. Saccharomyces cerevisiae YJM996 tRNA-Ile
    122. Saccharomyces eubayanus tRNA-Ile
    123. Saccharomyces pastorianus tRNA-Ile
    124. Torulaspora delbrueckii CBS 1146 tRNA
    125. Torulaspora delbrueckii tRNA-Ile
    126. Torulaspora globosa tRNA-Ile
    127. Torulaspora sp. CBS 2947 tRNA-Ile
    128. Xanthomonas citri pv. citri tRNA-Ile
    129. Zygosaccharomyces bailii ISA1307 transfer RNA-Ile(AAT)
    130. Zygosaccharomyces bailii transfer RNA-Ile(AAT)
    131. Zygosaccharomyces parabailii tRNA-Ile
    132. Zygotorulaspora mrakii tRNA-Ile
    2D structure New