Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-942-5p URS00005194EC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-942: Hsa-mir-942 is a microRNA that has been studied in various contexts. It is a "C/T" SNP located in the 3' strand of hsa-mir-942 [PMC4159108]. In different studies, hsa-mir-942 has been found to be differentially expressed in various tissues and diseases. For example, it was identified as one of the top 10 downregulated miRNAs in BN tissue samples compared to controls [PMC7057810]. It has also been found to be differentially expressed in FFPE tissues of early-stage lung cancer patients [PMC9610636]. In IL-2 depleted cells, hsa-mir-942 was predicted to potentially target the AKT3 gene [PMC4328098]. Furthermore, hsa-mir-942 has been associated with fracture risk in diabetic patients and survival in gastric cancer patients [PMC7288911] [PMC6794874]. It has also been shown to play regulatory roles in various cancers, including ovarian, lung, and colorectal cancers [PMC6805880]. Additionally, hsa-mir-942 has been detected in whole blood samples but not separated leukocyte subsets of lung cancer patients and healthy controls [PMC4253448]. The downregulation of hsa-mir-942 induces cell apoptosis during microbial infection and Influenza A virus infection [PMC6332841]. Furthermore, it is one of the miRNAs that regulate mRNAs predicted using the StarBase database and is associated with poor response to sunitinib treatment [PMC8197624] [PMC5444752]. Hsa-mir-942 also interacts with other miRNAs such as hsa-miR-23a and hsa-miR-15b that are associated with prognosis after analysis using UALCAN and Kaplan-Meier plotter analyses.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUUCUCUGUUUUGGCCAUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-942
Publications