v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila melanogaster (fruit fly) Drosophila_melanogaster piRNA piR-dme-33497 URS000051839C_7227

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGCAGUGUGGUUAGCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Anopheles gambiae aga-miR-34
  2. Drosophila erecta miR-34-RA
  3. Drosophila mojavensis miR-34-RA
  4. Drosophila persimilis miR-34-RA
  5. Drosophila sechellia miR-34-RA
  6. Drosophila simulans miR-34-RA
  7. Drosophila virilis miR-34-RA
  8. Drosophila willistoni miR-34-RA
  9. Epiblema scudderiana microRNA miR-34
  10. Eurosta solidaginis microRNA miR-34
  11. Tribolium castaneum tca-miR-34-5p