Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gadus morhua (Atlantic cod) gmo-miR-30c-5p URS00005165DA_8049

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Gadus morhua. Annotated by 1 database (miRBase). Described in 0 papers.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCUACACUCAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 80 other species

    1. Alligator mississippiensis ami-miR-30b-5p
    2. Anolis carolinensis aca-miR-30b-5p
    3. Bos taurus (cattle) bta-miR-30b-5p
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-30b
    5. Callorhinchus milii (elephant shark) eshark_mir-30_6
    6. Canis lupus familiaris (dog) cfa-miR-30b
    7. Capra hircus chi-miR-30b-5p
    8. Cavia porcellus cpo-miR-30b-5p
    9. Cervus elaphus (red deer) cel-miR-30b-5p
    10. Chiloscyllium plagiosum microRNA cpl-miR-30b
    11. Chrysemys picta bellii Cpi-Mir-30-P2c_5p (mature (guide))
    12. Chrysemys picta cpi-miR-30b-5p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
    14. Cyprinus carpio (common carp) ccr-miR-30b
    15. Danio rerio dre-miR-30b
    16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-5p
    17. Echinops telfairi Ete-Mir-30-P2c_5p (mature (guide))
    18. Equus caballus eca-miR-30b
    19. Gallus gallus (chicken) gga-miR-30b-5p
    20. Haplochromis burtoni abu-miR-30d
    21. Homo sapiens (human) hsa-miR-30b-5p
    22. Ictalurus punctatus ipu-miR-30b
    23. Macaca mulatta Mml-Mir-30-P2c_5p (mature (guide))
    24. Maylandia zebra (zebra mbuna) mze-miR-30d
    25. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
    26. Mus musculus mmu-miR-30b-5p
    27. Neolamprologus brichardi nbr-miR-30d
    28. Nomascus leucogenys nle-miR-30b
    29. Ophiophagus hannah oha-miR-30b-5p
    30. Oreochromis niloticus (Nile tilapia) oni-miR-30d
    31. Ornithorhynchus anatinus oan-miR-30b-5p
    32. Oryctolagus cuniculus ocu-miR-30b-5p
    33. Otolemur garnettii oga-miR-30b
    34. Ovis aries (sheep) miscellaneous RNA
    35. Pongo pygmaeus ppy-miR-30b
    36. Pteropus alecto (black flying fox) pal-miR-30b-5p
    37. Pundamilia nyererei pny-miR-30d
    38. Python bivittatus pbv-miR-30b-5p
    39. Rattus norvegicus rno-miR-30b-5p
    40. Salmo salar ssa-miR-30e-5p
    41. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2c_5p (mature (guide))
    42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-30-P2c_5p (mature (guide))
    43. Sus scrofa ssc-miR-30b-5p
    44. Taeniopygia guttata (zebra finch) tgu-miR-30e
    45. Takifugu rubripes fru-miR-30b
    46. Tetraodon nigroviridis tni-miR-30b
    47. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
    48. Tursiops truncatus miR-30b-5p
    49. Xenopus laevis xla-miR-30b-5p
    50. Xenopus tropicalis xtr-miR-30b