Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30b-5p URS00005165DA_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-30b: Mmu-mir-30b is a microRNA that has been studied in various contexts. Primers for mmu-mir-30b were purchased from Thermo Fisher Scientific for use in a TaqMan microRNA assay [PMC8262936]. In one study, an expression plasmid of mmu-mir-30b-5p and an empty vector control were purchased from Origene for mmu-mir-30b transfection experiments [PMC8745227]. Mmu-mir-30b, along with other miRNAs such as mmu-mir-30c, mmu-mir-21, and mmu-mir-206, is predicted to target TIMP-2 and TIMP-3 mRNAs [PMC3030602]. In another study, cells were cotransfected with Mkrn3 3' UTR-luc reporter and either a control vector or an expression vector for mmu-mir-30b [PMC6863565]. The Mkrn3 3' UTR luciferase reporter construct and the precursor expression plasmid for mmu-mir-30b were obtained from Genecopoeia [PMC6863565]. Furthermore, in a study on DIO mice, it was found that mmu-miR-16, mmu-miR17, and other miRNAs including mmu-miR21 and mmu-miR19b were downregulated in the DIO mice compared to DIO + LFD mice [PMC4571067]. These findings suggest that the expression of miRNAs such as mmu-mir-30b can be modulated in various biological contexts.

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUACACUCAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis ami-miR-30b-5p
  2. Anolis carolinensis (green anole) aca-miR-30b-5p
  3. Bos taurus (cattle) bta-miR-30b-5p
  4. Callithrix jacchus cja-miR-30b
  5. Callorhinchus milii Cmi-Mir-30-P2a_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-30b
  7. Capra hircus (goat) chi-miR-30b-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-30b-5p
  9. Cervus elaphus (red deer) cel-miR-30b-5p
  10. Chiloscyllium plagiosum microRNA cpl-miR-30b
  11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2a_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-30b-5p
  13. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
  14. Cyprinus carpio ccr-miR-30b
  15. Danio rerio dre-miR-30b
  16. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-5p
  17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2a_5p (mature (guide))
  18. Equus caballus eca-miR-30b
  19. Gadus morhua gmo-miR-30c-5p
  20. Gallus gallus (chicken) gga-miR-30b-5p
  21. Gekko japonicus Gja-Mir-30-P2a_5p (mature (guide))
  22. Haplochromis burtoni abu-miR-30d
  23. Homo sapiens hsa-miR-30b-5p
  24. Ictalurus punctatus ipu-miR-30b
  25. Latimeria chalumnae Lch-Mir-30-P2a_5p (mature (guide))
  26. Lepisosteus oculatus Loc-Mir-30-P2a_5p (mature (guide))
  27. Macaca mulatta (Rhesus monkey) Mml-Mir-30-P2a_5p (mature (guide))
  28. Maylandia zebra mze-miR-30d
  29. Microcaecilia unicolor Mun-Mir-30-P2a_5p (mature (guide))
  30. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
  31. Monopterus albus (swamp eel) Mal-Mir-30-P2a_5p (mature (guide))
  32. Neolamprologus brichardi (lyretail cichlid) nbr-miR-30d
  33. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-30b
  34. Ophiophagus hannah (king cobra) oha-miR-30b-5p
  35. Oreochromis niloticus oni-miR-30d
  36. Ornithorhynchus anatinus (platypus) oan-miR-30b-5p
  37. Oryctolagus cuniculus ocu-miR-30b-5p
  38. Otolemur garnettii (small-eared galago) oga-miR-30b
  39. Ovis aries miscellaneous RNA
  40. Pongo pygmaeus (Bornean orangutan) ppy-miR-30b
  41. Pteropus alecto pal-miR-30b-5p
  42. Pundamilia nyererei pny-miR-30d
  43. Python bivittatus (Burmese python) pbv-miR-30b-5p
  44. Rattus norvegicus rno-miR-30b-5p
  45. Salmo salar (Atlantic salmon) ssa-miR-30e-5p
  46. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-30-P2a_5p (mature (guide))
  47. Scyliorhinus torazame Sto-Mir-30-P2a_5p (mature (guide))
  48. Sphenodon punctatus (tuatara) Spt-Mir-30-P2a_5p (mature (guide))
  49. Sus scrofa (pig) ssc-miR-30b-5p
  50. Taeniopygia guttata tgu-miR-30e
  51. Takifugu rubripes (torafugu) fru-miR-30b
  52. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-30b
  53. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
  54. Tursiops truncatus (common bottlenose dolphin) miR-30b-5p
  55. Xenopus laevis xla-miR-30b-5p
  56. Xenopus tropicalis xtr-miR-30b
Publications