Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30b-5p URS00005165DA_10090

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Mus musculus. Annotated by 7 databases (PirBase, LncBase, ENA, miRBase, RefSeq, MirGeneDB, TarBase). Described in 32 papers. Mus musculus (house mouse) mmu-miR-30b-5p sequence is a product of mmu-miR-30b-5p, mmu-miR-30b, miR-30b-5p, miR-30b, miR-30, Mir30b genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610009F02Rik, 0610009M14Rik, 0610010I13Rik, 0610010I17Rik, 0610010O12Rik, 0610012C09Rik, 0610025L15Rik, 0610030A03Rik, 0610037O16Rik, 0610040J01Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGUAAACAUCCUACACUCAGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 49 other species

    1. Alligator mississippiensis ami-miR-30b-5p
    2. Anolis carolinensis aca-miR-30b-5p
    3. Bos taurus (cattle) bta-miR-30b-5p
    4. Callithrix jacchus cja-miR-30b
    5. Callorhinchus milii (elephant shark) eshark_mir-30_6
    6. Canis lupus familiaris (dog) cfa-miR-30b
    7. Capra hircus (goat) chi-miR-30b-5p
    8. Cavia porcellus cpo-miR-30b-5p
    9. Cervus elaphus (red deer) cel-miR-30b-5p
    10. Chiloscyllium plagiosum microRNA cpl-miR-30b
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-30-P2c_5p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-30b-5p
    13. Cricetulus griseus (Chinese hamster) cgr-miR-30b-5p
    14. Cyprinus carpio ccr-miR-30b
    15. Danio rerio dre-miR-30b
    16. Dasypus novemcinctus dno-miR-30b-5p
    17. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-30-P2c_5p (mature (guide))
    18. Equus caballus (horse) eca-miR-30b
    19. Gadus morhua gmo-miR-30c-5p
    20. Gallus gallus (chicken) gga-miR-30b-5p
    21. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30d
    22. Homo sapiens (human) hsa-miR-30b-5p
    23. Ictalurus punctatus ipu-miR-30b
    24. Macaca mulatta Mml-Mir-30-P2c_5p (mature (guide))
    25. Maylandia zebra mze-miR-30d
    26. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-5p
    27. Neolamprologus brichardi nbr-miR-30d
    28. Nomascus leucogenys nle-miR-30b
    29. Ophiophagus hannah oha-miR-30b-5p
    30. Oreochromis niloticus (Nile tilapia) oni-miR-30d
    31. Ornithorhynchus anatinus oan-miR-30b-5p
    32. Oryctolagus cuniculus (rabbit) ocu-miR-30b-5p
    33. Otolemur garnettii (small-eared galago) oga-miR-30b
    34. Ovis aries miscellaneous RNA
    35. Pongo pygmaeus ppy-miR-30b
    36. Pteropus alecto pal-miR-30b-5p
    37. Pundamilia nyererei pny-miR-30d
    38. Python bivittatus (Burmese python) pbv-miR-30b-5p
    39. Rattus norvegicus (Norway rat) rno-miR-30b-5p
    40. Salmo salar ssa-miR-30e-5p
    41. Sarcophilus harrisii Sha-Mir-30-P2c_5p (mature (guide))
    42. Scyliorhinus torazame (cloudy catshark) Sto-Mir-30-P2c_5p (mature (guide))
    43. Sus scrofa (pig) ssc-miR-30b-5p
    44. Taeniopygia guttata (zebra finch) tgu-miR-30e
    45. Takifugu rubripes (torafugu) fru-miR-30b
    46. Tetraodon nigroviridis tni-miR-30b
    47. Tupaia chinensis (Chinese tree shrew) tch-miR-30b-5p
    48. Tursiops truncatus (common bottlenose dolphin) miR-30b-5p
    49. Xenopus laevis (African clawed frog) xla-miR-30b-5p
    50. Xenopus tropicalis xtr-miR-30b