Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-miR-281-2-5p URS000050FEA6_7244

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila virilis. Annotated by 2 databases (Ensembl Metazoa, miRBase). Drosophila virilis dvi-miR-281-2-5p sequence is a product of FBtr0297087_df_nrg gene. Found in the Drosophila virilis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGAGAGCUAUCCGUCGACAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Blattella germanica Bge-Mir-281_5p (mature (guide))
    2. Bombyx mori bmo-miR-281-5p
    3. Culex quinquefasciatus cqu-miR-281-5p
    4. Drosophila ananassae dan-miR-281-2-5p
    5. Drosophila erecta der-miR-281-2-5p
    6. Drosophila grimshawi dgr-miR-281-2-5p
    7. Drosophila melanogaster (fruit fly) dme-miR-281-2-5p
    8. Drosophila mojavensis dmo-miR-281-2-5p
    9. Drosophila persimilis dpe-miR-281-2-5p
    10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294408_df_nrg
    11. Drosophila sechellia dse-miR-281-2-5p
    12. Drosophila simulans Dsi-Mir-281-P2-v1_5p (mature (co-guide))
    13. Drosophila willistoni dwi-miR-281-2-5p
    14. Drosophila yakuba dya-miR-281-2-5p
    15. Locusta migratoria lmi-miR-281-5p
    16. Penaeus japonicus miR-281-2*
    17. Spodoptera frugiperda (fall armyworm) sfr-miR-281-5p
    18. Tribolium castaneum (red flour beetle) tca-miR-281-5p
    19. Triops cancriformis tcf-miR-281-5p