Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-let-7c-5p URS000050DE77_7955

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Danio rerio. Annotated by 4 databases (miRBase, RefSeq, MirGeneDB, ENA). Described in 9 papers. Danio rerio (zebrafish) dre-let-7c-5p sequence is a product of dre-let-7c-5p, let-7, mirlet7c-1, let-7c, mirlet7c-2, let-7c-5p, dre-let-7c genes. Found in the zebrafish reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGAGGUAGUAGGUUGUAUGGUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 87 other species

    1. Alligator mississippiensis ami-let-7c-5p
    2. Anolis carolinensis aca-let-7c-5p
    3. Bos taurus (cattle) bta-let-7c
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-let-7c
    5. Canis lupus familiaris (dog) cfa-let-7c
    6. Capra hircus chi-let-7c-5p
    7. Cavia porcellus cpo-let-7c-5p
    8. Cervus elaphus (red deer) cel-let-7c
    9. Chrysemys picta bellii Cpi-Let-7-P1b_5p (mature (guide))
    10. Chrysemys picta cpi-let-7c-5p
    11. Columba livia cli-let-7c-5p
    12. Daphnia pulex (common water flea) Dpu-Let-7_5p (mature (guide))
    13. Dasypus novemcinctus (nine-banded armadillo) dno-let-7c-5p
    14. Daubentonia madagascariensis dma-let-7c
    15. Echinops telfairi Ete-Let-7-P1c_5p (mature (guide))
    16. Equus caballus eca-let-7c
    17. Gadus morhua (Atlantic cod) gmo-let-7c-5p
    18. Gallus gallus (chicken) gga-let-7c-5p
    19. Gorilla gorilla (western gorilla) microRNA let-7c
    20. Haplochromis burtoni abu-let-7c
    21. Hippoglossus hippoglossus (Atlantic halibut) hhi-let-7c
    22. Homo sapiens (human) hsa-let-7c-5p
    23. Ictalurus punctatus ipu-let-7c
    24. Lagothrix lagotricha (brown woolly monkey) microRNA let-7c
    25. Macaca mulatta mml-let-7c-5p
    26. Macaca nemestrina microRNA let-7c
    27. Maylandia zebra (zebra mbuna) mze-let-7c
    28. Microcebus murinus (gray mouse lemur) mmr-let-7c
    29. Mus musculus mmu-let-7c-5p
    30. Neolamprologus brichardi nbr-let-7c
    31. Nomascus leucogenys nle-let-7c
    32. Ophiophagus hannah oha-let-7c-5p
    33. Oreochromis niloticus (Nile tilapia) oni-let-7c
    34. Ornithorhynchus anatinus oan-let-7c-5p
    35. Oryctolagus cuniculus ocu-let-7c-5p
    36. Otolemur garnettii oga-let-7c
    37. Ovis aries (sheep) oar-let-7c
    38. Pan paniscus ppa-let-7c
    39. Pan troglodytes (chimpanzee) ptr-let-7c
    40. Papio hamadryas pha-let-7c
    41. Paralichthys olivaceus (Japanese flounder) pol-let-7a-5p
    42. Pongo pygmaeus ppy-let-7c
    43. Pteropus alecto (black flying fox) pal-let-7c-5p
    44. Pundamilia nyererei pny-let-7c
    45. Python bivittatus pbv-let-7c-5p
    46. Rattus norvegicus rno-let-7c-5p
    47. Saguinus labiatus microRNA let-7c
    48. Salmo salar ssa-let-7c-5p
    49. Sarcophilus harrisii (Tasmanian devil) Sha-Let-7-P1c_5p (mature (guide))
    50. Sus scrofa ssc-let-7c
    51. Taeniopygia guttata (zebra finch) tgu-let-7c-5p
    52. Tor tambroides let-7c-5p
    53. Triops cancriformis tcf-let-7-5p
    54. Xenopus laevis xla-let-7c-5p
    55. Xenopus tropicalis xtr-let-7c