Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 628 (ENSGGOG00000030821.2) secondary structure diagram

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 628 (ENSGGOG00000030821.2) URS000050D31F_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAGCUGUUGUGUCACUUCCUCAUGCUGACAUAUUUACUAGAGGGUAAAAUUAAUAACCUUCUAGUAAGAGUGGCAGUCGAAGGGAAGGGCUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 32 other species

  1. Ailuropoda melanoleuca (giant panda) mir-628
  2. Bison bison bison microRNA 628 (ENSBBBG00000001099.1)
  3. Bos grunniens (domestic yak) microRNA 628 (ENSBGRG00000016509.1)
  4. Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000019994.1, ENSBIXG00005017366.1)
  5. Bos mutus microRNA 628 (ENSBMUG00000008954.1)
  6. Bos taurus microRNA bta-mir-628 precursor
  7. Canis lupus familiaris (dog) microRNA cfa-mir-628 precursor
  8. Cebus imitator (Panamanian white-faced capuchin) microRNA 628 (ENSCCAG00000007651.1)
  9. Cervus hanglu yarkandensis microRNA 628 (ENSCHYG00000021805.1)
  10. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000037701.1)
  11. Equus caballus microRNA eca-mir-628a precursor
  12. Felis catus microRNA 628 (ENSFCAG00000016659.3)
  13. Homo sapiens microRNA hsa-mir-628 precursor
  14. Lynx canadensis (Canada lynx) microRNA 628 (ENSLCNG00005011162.1)
  15. Moschus moschiferus (Siberian musk deer) microRNA 628 (ENSMMSG00000006563.1)
  16. Mustela putorius furo microRNA 628 (ENSMPUG00000021524.1)
  17. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 628 (ENSNLEG00000021209.2)
  18. Otolemur garnettii microRNA 628 (ENSOGAG00000017461.1)
  19. Pan paniscus microRNA 628 (ENSPPAG00000018319.1)
  20. Panthera leo microRNA 628 (ENSPLOG00000002152.1)
  21. Panthera pardus (leopard) microRNA 628 (ENSPPRG00000013702.1)
  22. Panthera tigris altaica miRNA (ENSPTIG00000003107.1)
  23. Pan troglodytes ptr-mir-628 (ENSPTRG00000027915.2)
  24. Pongo abelii (Sumatran orangutan) miRNA
  25. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-628 precursor
  26. Saimiri boliviensis boliviensis microRNA 628 (ENSSBOG00000000976.1)
  27. Tursiops truncatus (bottlenosed dolphin) microRNA 628 (ENSTTRG00000022182.1)
2D structure Publications