Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tursiops truncatus (bottlenosed dolphin) microRNA 628 (ENSTTRG00000022182.1) secondary structure diagram

Tursiops truncatus (bottlenosed dolphin) microRNA 628 (ENSTTRG00000022182.1) URS000050D31F_9739

Automated summary: This pre miRNA sequence is 95 nucleotides long and is found in Tursiops truncatus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-628, RF01012). Tursiops truncatus (bottlenosed dolphin) microRNA 628 (ENSTTRG00000022182.1) sequence is a product of ENSTTRG00000022182.1 gene. Found in the bottlenosed dolphin reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAGCUGUUGUGUCACUUCCUCAUGCUGACAUAUUUACUAGAGGGUAAAAUUAAUAACCUUCUAGUAAGAGUGGCAGUCGAAGGGAAGGGCUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    2D structure New