Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-628 precursor secondary structure diagram

Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-628 precursor URS000050D31F_9600

Automated summary: This pre miRNA sequence is 95 nucleotides long and is found in Pongo pygmaeus. Annotated by 1 database (miRBase). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-628, RF01012).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAGCUGUUGUGUCACUUCCUCAUGCUGACAUAUUUACUAGAGGGUAAAAUUAAUAACCUUCUAGUAAGAGUGGCAGUCGAAGGGAAGGGCUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Ailuropoda melanoleuca microRNA mir-628
    2. Bison bison bison (American bison) miRNA
    3. Bos grunniens (domestic yak) microRNA 628
    4. Bos indicus x Bos taurus microRNA 628
    5. Bos mutus microRNA 628
    6. Bos taurus microRNA bta-mir-628 precursor
    7. Canis lupus familiaris microRNA cfa-mir-628 precursor
    8. Cervus hanglu yarkandensis (Yarkand deer) miRNA
    9. Colobus angolensis palliatus microRNA 628
    10. Equus caballus (horse) microRNA eca-mir-628a precursor
    11. Felis catus miRNA
    12. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 628
    13. Homo sapiens microRNA hsa-mir-628 precursor
    14. Lynx canadensis (Canada lynx) microRNA 628
    15. Moschus moschiferus microRNA 628
    16. Mustela putorius furo (Domestic ferret) microRNA 628 (MIR628)
    17. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    18. Otolemur garnettii (small-eared galago) miRNA
    19. Pan paniscus (bonobo) miRNA
    20. Panthera leo (lion) microRNA 628
    21. Panthera pardus microRNA 628
    22. Panthera tigris altaica (Tiger) microRNA 628
    23. Pan troglodytes (chimpanzee) ptr-mir-628
    24. Pongo abelii microRNA 628
    25. Saimiri boliviensis boliviensis miRNA
    26. Tursiops truncatus (bottlenosed dolphin) microRNA 628
    2D structure New