Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000000976.1) secondary structure diagram

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000000976.1) URS000050D31F_39432

Automated summary: This pre miRNA sequence is 95 nucleotides long and is found in Saimiri boliviensis boliviensis. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-628, RF01012). Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000000976.1) sequence is a product of ENSSBOG00000000976.1 gene. Found in the bolivian squirrel monkey reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUAGCUGUUGUGUCACUUCCUCAUGCUGACAUAUUUACUAGAGGGUAAAAUUAAUAACCUUCUAGUAAGAGUGGCAGUCGAAGGGAAGGGCUCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    2D structure New