Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1983 URS000050CF2F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1983: Mmu-mir-1983 is a miRNA that has been identified as a core regulator in various biological processes. It has been shown to influence the expression of HIF1A and NOS2 through interactions with other lncRNAs and miRNAs [PMC8368776]. The expression of mmu-mir-1983 in mice was assessed using TaqMan RT-PCR assays [PMC4386824]. Additionally, a homolog of mmu-mir-1983 has been found in human skin, indicating its conservation across species [PMC4695841]. In different studies, mmu-mir-1983 was found to be up-regulated in various contexts, such as skin and heart development [PMC8291871] [PMC8825596]. It was also identified as a master regulator of heart development and hair follicle development, suggesting its crucial role in these processes [PMC8825596]. Overall, mmu-mir-1983 is an important miRNA that plays diverse roles in different biological contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCACCUGGAGCAUGUUUUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications