Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 18 (TTTY18) URS000050BE5C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY18: TTTY18 is a long noncoding RNA (lncRNA) that has been implicated in various biological processes, including cancer. In a study, three different congeners (BDE-47, BDE-99, and BDE-209) were found to induce seven differentially expressed lncRNAs (DELs), including TTTY18 [PMC9697228]. Another study showed that genistein (GEN), a compound with anticancer properties, downregulated TTTY18 expression and inhibited the TTTY18/AKT pathway in colorectal cancer (CRC) cells [PMC9774417]. In vitro experiments with genistein-dosed CRC cells demonstrated reduced cell viability, increased cell death, decreased cell migration, and downregulated levels of SGK1, TTTY18, AktSer473, and p38 MAPKTyr323 [PMC9259214]. Furthermore, CRC cases showed elevated levels of TTTY18 expression along with increased expressions of transforming growth factor beta-1 (TGF-1), serum and glucocorticoid regulated kinase-1 (SGK1), Ki-67, and Akt-Ser473 [PMC9259214]. In an in vivo investigation using genistein-dosed tumor-bearing nude mice, decreased tumorous concentrations of TGF-1 and TTTY18 were observed along with reduced body mass [PMC9259214]. Additionally, the UTY and CYG2P1 genes exhibited changes in the CG intron site while SPRY3 and TTTY18 showed no obvious changes [PMC10083376]. These findings highlight the involvement of TTTY18 in cancer development and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCACAGUUUGAUGUAUGGCAACACUGCUCCACUUUGGACAUGCCUUUGUCGUGGUUCCUGCCUUUCCCAGAGAGCCCCUCGGAGGCCCAAAAUGAAGAGAGGCAAUGAAGUCAAGGGCCCGGCUAUCAUUCACUGACACCCACUUUUGGGGAUCUUAGGCAGGGUGACAGCUCUGAGAGCCAGGAGCCCGAGUCUGUCUCAAGAACUUGCACAUGCCUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications